Molecule Information

General Information of the Molecule (ID: Mol01438)

Name	hsa-mir-127 ,Homo sapiens
Synonyms	microRNA 127 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR127
Gene ID	406914
Location	chr14:100882979-100883075[+]
Sequence	UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGG AUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC Click to Show/Hide
Ensembl ID	ENSG00000207608
HGNC ID	HGNC:31509
Precursor Accession	MI0000472
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Glioma				[1]
Sensitive Disease	Glioma [ICD-11: 2A00.1]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	AKT signaling pathway		Inhibition	hsa04151
	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	U251 cells	Brain	Homo sapiens (Human)	CVCL_0021
	U87-MG cells	Brain	Homo sapiens (Human)	CVCL_0022
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay; Flow cytometry assay
Mechanism Description	microRNA-127 silencing significantly affects cell growth and increases the sensitivity to adriamycin. microRNA-127 silencing arrests the cell cycle, potentiates adriamycin-induced apoptosis, and increases cellular Rh-123 uptake. microRNA-127 silencing down-regulates MDR1, MRP1, Runx2, Bcl-2, Survivin and ErbB4 expression while up-regulates p53 expression. microRNA-127 silencing inhibits AkT phosphorylation.

References

Ref 1	Knockdown of microRNA-127 reverses adriamycin resistance via cell cycle arrest and apoptosis sensitization in adriamycin-resistant human glioma cells. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6107-16. eCollection 2015.