Molecule Information

General Information of the Molecule (ID: Mol01437)

• Name: hsa-mir-126 ,Homo sapiens
• Synonyms: microRNA 126
• Molecule Type: Precursor miRNA
• Gene Name: MIR126
• Gene ID: 406913
• Location: chr9:136670602-136670686[+]
• Sequence:
  CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGU
  GAGUAAUAAUGCGCCGUCCACGGCA
• Ensembl ID: ENSG00000199161
• HGNC ID: HGNC:31508
• Precursor Accession: MI0000471

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Bleomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [1]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Bleomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Upregulation of miR-126 inhibited cervical cancer cell proliferation and enhanced the sensitivity to BLM. Thus, miR-126 may represent a novel approach to cervical cancer treatment.

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [2]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/MRP1 signaling pathway; Activation; hsa04151
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC-7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC-823/DDP cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: qRT-PCR; Dual-luciferase reporter assay
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric cell cycle assay; Annexin V-FITC Apoptosis assay
• Mechanism Description: LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR126 to activate the PI3k/AkT/MRP1 genes.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Caspase3/7 activity assay
• Mechanism Description: microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2.

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [6]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Over-expression of miR-126 in colon cancer cell was able to inhibit cell proliferation, promote cell apoptosis and reduce the invasive ability. miR-126 significantly enhanced the sensitivity of the colon cancer cell to chemotherapeutic drug. It has been shown that IRS1, SLC75A and TOM1 were the potential target genes of miR-126 in colon cancer.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Caspase3/7 activity assay
• Mechanism Description: microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2.

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1.

Epigallocatechin gallate

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [7]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Epigallocatechin gallate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: Flow cytometry assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [8]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer miR126 promotes TRAIL-induced apoptosis in TRAIL-resistant cervical cancer cells and increases the sensitivity of Hela-TR and SiHa-TR to TNF-alphaand FasL.

References

• Ref 1: miR-126 Suppresses the proliferation of cervical cancer cells and alters cell sensitivity to the chemotherapeutic drug bleomycin. Asian Pac J Cancer Prev. 2014 Jan;14(11):6569-72. doi: 10.7314/apjcp.2013.14.11.6569.
• Ref 2: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 3: LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR-126 to activate the PI3K/AKT/MRP1 genes. Tumour Biol. 2016 Nov 30. doi: 10.1007/s13277-016-5448-5. Online ahead of print.
• Ref 4: MicroRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. Biochem Biophys Res Commun. 2016 Oct 7;479(1):91-6. doi: 10.1016/j.bbrc.2016.09.040. Epub 2016 Sep 10.
• Ref 5: miR-126 enhances the sensitivity of non-small cell lung cancer cells to anticancer agents by targeting vascular endothelial growth factor A. Acta Biochim Biophys Sin (Shanghai). 2012 Jun;44(6):519-26. doi: 10.1093/abbs/gms026. Epub 2012 Apr 16.
• Ref 6: [miR-126 inhibits colon cancer proliferation and invasion through targeting IRS1, SLC7A5 and TOM1 gene]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2013 Aug;38(8):809-17. doi: 10.3969/j.issn.1672-7347.2013.08.009.
• Ref 7: Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate. World J Surg Oncol. 2014 Dec 16;12:383. doi: 10.1186/1477-7819-12-383.
• Ref 8: MiR-126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer. Gene. 2017 Sep 5;627:420-427. doi: 10.1016/j.gene.2017.06.055. Epub 2017 Jun 29.