Molecule Information

General Information of the Molecule (ID: Mol01436)

Name	hsa-mir-125b-2 ,Homo sapiens
Synonyms	microRNA 125b-2 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR125B2
Gene ID	406912
Location	chr21:16590237-16590325[+]
Sequence	ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAG UCAGGCUCUUGGGACCUAGGCGGAGGGGA Click to Show/Hide
Ensembl ID	ENSG00000207863
HGNC ID	HGNC:31507
Precursor Accession	MI0000470
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Temozolomide

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Glioblastoma				[1]
Resistant Disease	Glioblastoma [ICD-11: 2A00.02]			Disease Info
Resistant Drug	Temozolomide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Mitochondrial apoptotic signaling pathway		Inhibition	hsa04210
In Vitro Model	Human glioblastoma tissues and PRGMTTT samples	Brain	Homo sapiens (Human)	N.A.
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-125b-2 is overexpressed in glioblastoma multiforme tissues and the corresponding stem cells (GBMSC); downregulation of miR-125b-2 expression in GBMSC could allow TMZ to induce GBMSC apoptosis. Additionally, the expression of the anti-apop-totic protein Bcl-2 was decreased after the TMZ+miR-125b-2 inhibitor treatment, while the expression of the proapoptotic protein Bax was increased. he induction of apoptosis in GBMSC is also associated with increased cytochrome c release from mitochondria, induction of Apaf-1, activation of caspase-3 and poly-ADP-ribose polymerase (PARP). miR-125b-2 overexpression might confer glioblastoma stem cells resistance to TMZ.

References

Ref 1	MicroRNA-125b-2 confers human glioblastoma stem cells resistance to temozolomide through the mitochondrial pathway of apoptosis. Int J Oncol. 2012 Jan;40(1):119-29. doi: 10.3892/ijo.2011.1179. Epub 2011 Aug 29.