Molecule Information

General Information of the Molecule (ID: Mol01433)

• Name: hsa-mir-153 ,Homo sapiens
• Synonyms: microRNA 153-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR153-1
• Gene ID: 406944
• Location: chr2:219294111-219294200[-]
• Sequence:
  CUCACAGCUGCCAGUGUCAUUUUUGUGAUCUGCAGCUAGUAUUCUCACUCCAGUUGCAUA
  GUCACAAAAGUGAUCAUUGGCAGGUGUGGC
• Ensembl ID: ENSG00000207647
• HGNC ID: HGNC:31539
• Precursor Accession: MI0000463

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Arsenic trioxide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [1]

• Sensitive Disease: Leukemia [ICD-11: 2B33.6]
• Sensitive Drug: Arsenic trioxide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Forced expression of miR-153 only in k562 cells has no significant effects on cell growth and apoptosis. However, when cells were additionally treated with As2O3, significant greater apoptosis was observed in the miR-153 overexpressed group.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SW48 cells; Colon; Homo sapiens (Human); CVCL_1724
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Soft agar colony forming ability assay; Flow cytometry assay
• Mechanism Description: miR-153 promoted invasiveness indirectly by inducing MMP9 production, whereas drug resistance was mediated directly by inhibiting the Forkhead transcription factor FOXO3a.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [3]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Annexin-V/PI Apoptosis assay; TUNEL assay
• Mechanism Description: miR153 enhanced gemcitabine sensitivity by targeting Snail in pancreatic cancer.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SW48 cells; Colon; Homo sapiens (Human); CVCL_1724
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Soft agar colony forming ability assay; Flow cytometry assay
• Mechanism Description: miR-153 promoted invasiveness indirectly by inducing MMP9 production, whereas drug resistance was mediated directly by inhibiting the Forkhead transcription factor FOXO3a.

References

• Ref 1: miR-153 sensitized the K562 cells to As2O3-induced apoptosis. Med Oncol. 2012 Mar;29(1):243-7. doi: 10.1007/s12032-010-9807-6. Epub 2011 Jan 26.
• Ref 2: miR-153 supports colorectal cancer progression via pleiotropic effects that enhance invasion and chemotherapeutic resistance. Cancer Res. 2013 Nov 1;73(21):6435-47. doi: 10.1158/0008-5472.CAN-12-3308. Epub 2013 Aug 15.
• Ref 3: miR-153 enhances the therapeutic effect of gemcitabine by targeting Snail in pancreatic cancer. Acta Biochim Biophys Sin (Shanghai). 2017 Jun 1;49(6):520-529. doi: 10.1093/abbs/gmx039.