Molecule Information

General Information of the Molecule (ID: Mol01432)

• Name: hsa-mir-152 ,Homo sapiens
• Synonyms: microRNA 152
• Molecule Type: Precursor miRNA
• Gene Name: MIR152
• Gene ID: 406943
• Location: chr17:48037161-48037247[-]
• Sequence:
  UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGC
  AUGACAGAACUUGGGCCCGGAAGGACC
• Ensembl ID: ENSG00000207947
• HGNC ID: HGNC:31538
• Precursor Accession: MI0000462

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: CD-1/CD-1 nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies.

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780/DDP cells; Ovary; Homo sapiens (Human); CVCL_D619
• In Vivo Model: CD-1/CD-1 nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: c-Met/PI3K/AKT signaling pathway; Activation; hsa01521
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Soft agar assay
• Mechanism Description: LncRNAPVT1 targets miR-152 to enhance chemoresistance of osteosarcoma to doxorubicin through activating c-MET/PI3k/AkT pathway.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: c-Met/PI3K/AKT signaling pathway; Activation; hsa01521
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Soft agar assay
• Mechanism Description: LncRNAPVT1 targets miR-152 to enhance chemoresistance of osteosarcoma to gemcitabine through activating c-MET/PI3k/AkT pathway.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-FITC Apoptosis Detection assay; Flow cytometry assay
• Mechanism Description: miR148a and miR152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM.

References

• Ref 1: MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene. 2014 Jan 16;33(3):378-86. doi: 10.1038/onc.2012.575. Epub 2013 Jan 14.
• Ref 2: lncRNAPVT1 targets miR-152 to enhance chemoresistance of osteosarcoma to gemcitabine through activating c-MET/PI3K/AKT pathway. Pathol Res Pract. 2019 Mar;215(3):555-563. doi: 10.1016/j.prp.2018.12.013. Epub 2018 Dec 12.
• Ref 3: MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846. doi: 10.1016/j.bbrc.2017.01.012. Epub 2017 Jan 4.