Molecule Information

General Information of the Molecule (ID: Mol01430)

• Name: hsa-mir-144 ,Homo sapiens
• Synonyms: microRNA 144
• Molecule Type: Precursor miRNA
• Gene Name: MIR144
• Gene ID: 406936
• Location: chr17:28861533-28861618[-]
• Sequence:
  UGGGGCCCUGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCGAUGAGACACUACAGUAUA
  GAUGAUGUACUAGUCCGGGCACCCCC
• Ensembl ID: ENSG00000283819
• HGNC ID: HGNC:31531
• Precursor Accession: MI0000460

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Anaplastic thyroid carcinoma [2]

• Sensitive Disease: Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: TPC-1 cells; Thyroid; Homo sapiens (Human); CVCL_6298
• In Vitro Model: ARO cells; Thyroid; Homo sapiens (Human); CVCL_0144
• In Vitro Model: HTori3 cell; Thyroid; Homo sapiens (Human); CVCL_4W02
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; TUNEL assay
• Mechanism Description: miR-144 could inhibit autophagy of ATC cells by down-regulating TGF-alpha, enhancing the cisplatin-sensitivity of ATC cells.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [3]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: c-Myc expression was upregulated in the imatinib resistant k562R cells, which in turn increased the expression of miR-144/451, restoration of miR-144/451 or knockdown of Myc could sensitize the imatinib resistant cells to apoptosis. Myc, miR-144/451 form a regulatory pathway and contribute to the imatinib resistance.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [4]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• Experiment for Molecule Alteration: Western blotting analysis
• Experiment for Drug Resistance: Colorimetric SRB assay
• Mechanism Description: The increase of miR-144 levels, shown to be downregulated in U87 and DBTRG human GB cell lines, as well as in GB tumor samples, promoted the downregulation of mRNA of enzymes involved in bioenergetic pathways, with consequent alterations in cell metabolism, impairment of migratory capacity, and sensitization of DBTRG cells to a chemotherapeutic drug, the dichloroacetate (DCA).

Dichloroacetate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [4]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Dichloroacetate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: DBTRG cells; Brain; Homo sapiens (Human); CVCL_1169
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Colorimetric SRB assay
• Mechanism Description: The potential of miR-144 overexpression to reduce GB cell malignancy, both by decreasing Cell migration and invasion abilities and by sensitizing resistant tumor cells to chemotherapy, paving the way to a novel and more effective GB therapy.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: Effects of miR-144 on the sensitivity of human anaplastic thyroid carcinoma cells to cisplatin by autophagy regulation. Cancer Biol Ther. 2018 Jun 3;19(6):484-496. doi: 10.1080/15384047.2018.1433502. Epub 2018 Mar 26.
• Ref 3: Myc induced miR-144/451 contributes to the acquired imatinib resistance in chronic myelogenous leukemia cell K562. Biochem Biophys Res Commun. 2012 Aug 24;425(2):368-73. doi: 10.1016/j.bbrc.2012.07.098. Epub 2012 Jul 27.
• Ref 4: MiR-144 overexpression as a promising therapeutic strategy to overcome glioblastoma cell invasiveness and resistance to chemotherapy. Hum Mol Genet. 2019 Aug 15;28(16):2738-2751. doi: 10.1093/hmg/ddz099.