Molecule Information

General Information of the Molecule (ID: Mol01422)
Name
hsa-mir-135a ,Homo sapiens
Synonyms
microRNA 135a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR135A1
Gene ID
406925
Location
chr3:52294219-52294308[-]
Sequence
AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAG
GGAUUGGAGCCGUGGCGCACGGCGGGGACA
    Click to Show/Hide
Ensembl ID
ENSG00000207926
HGNC ID
HGNC:31520
Precursor Accession
MI0000452
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in partby modulation of apoptosis via targeting MCL1.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [2]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Promega viability kit assay
Mechanism Description Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [2]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Promega viability kit assay
Mechanism Description Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell viability Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay; Transwell assay
Mechanism Description miR-135a promoted cell growth and metastasis and activated the PI3k/AkT signaling pathway via a RAC1-dependent manner.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [4]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
JAKT/STAT signaling pathway Inhibition hsa04630
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
H157 cells Lung Homo sapiens (Human) CVCL_2458
H4006 cells Lung Homo sapiens (Human) N.A.
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR135 acted as a tumor promoter, and its suppression could improve sensitivity to gefitinib by targeting TRIM16 and inhibition of the JAk/STAT pathway.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [5]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Sp1/DAPK2 signaling signaling pathway Inhibition hsa05231
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MGC-803/OXA cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901/OXA cells Gastric Homo sapiens (Human) CVCL_B0A1
SNU-5 cells Gastric Homo sapiens (Human) CVCL_0078
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR135a promotes gastric cancer progression and resistance to oxaliplatin. The mechanism whereby miR135a promotes GC pathogenesis appears to be the suppression of E2F1 expression and Sp1/DAPk2 pathway signaling.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC.
Disease Class: Non-small cell lung cancer [6]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC.
Disease Class: Ovarian cancer [6]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC.
Disease Class: Prostate cancer [6]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC.
Disease Class: Uterine sarcoma [6]
Resistant Disease Uterine sarcoma [ICD-11: 2C72.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC.
References
Ref 1 miR-135a/b modulate cisplatin resistance of human lung cancer cell line by targeting MCL1. Pathol Oncol Res. 2013 Oct;19(4):677-83. doi: 10.1007/s12253-013-9630-4. Epub 2013 May 3.
Ref 2 MiR-138 and MiR-135 directly target focal adhesion kinase, inhibit cell invasion, and increase sensitivity to chemotherapy in cancer cells. Anticancer Agents Med Chem. 2014 Jan;14(1):18-28. doi: 10.2174/187152061401140108113435.
Ref 3 miR-135a Confers Resistance to Gefitinib in Non-Small Cell Lung Cancer Cells by Upregulation of RAC1. Oncol Res. 2018 Sep 14;26(8):1191-1200. doi: 10.3727/096504018X15166204902353. Epub 2018 Jan 31.
Ref 4 Downregulation of MicroRNA-135 Promotes Sensitivity of Non-Small Cell Lung Cancer to Gefitinib by Targeting TRIM16. Oncol Res. 2018 Aug 23;26(7):1005-1014. doi: 10.3727/096504017X15144755633680. Epub 2018 Jan 2.
Ref 5 miR-135a promotes gastric cancer progression and resistance to oxaliplatin. Oncotarget. 2016 Oct 25;7(43):70699-70714. doi: 10.18632/oncotarget.12208.
Ref 6 miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo. Oncogene. 2011 Oct 27;30(43):4386-98. doi: 10.1038/onc.2011.148. Epub 2011 May 9.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.