Molecule Information

General Information of the Molecule (ID: Mol01421)

• Name: hsa-mir-133a ,Homo sapiens
• Synonyms: microRNA 133a-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR133A1
• Gene ID: 406922
• Location: chr18:21825698-21825785[-]
• Sequence:
  ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCC
  CCUUCAACCAGCUGUAGCUAUGCAUUGA
• Ensembl ID: ENSG00000283927
• HGNC ID: HGNC:31517
• Precursor Accession: MI0000450

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal carcinoma [1]

• Sensitive Disease: Laryngeal carcinoma [ICD-11: 2C23.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vitro Model: NP69 cells; Nasopharynx; Homo sapiens (Human); CVCL_F755
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hep-2v cells persistently express high levels of ATP7B, and cisplatin treatment stimulates increased ATP7B expression of ATP7B in these cells. ATP7B contributes to the removal of intracellular cisplatin to the extracellular space, thereby promoting cell survival. However, ATP7B expression was significantly decreased following exogenous expression of miR-133a. Reduced levels of ATP7B likely impaired the transportation of cisplatin to the extracellular space, thereby increasing the sensitivity of Hep-2v cells to cisplatin.

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/DOX cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: CVCL_4V97; Breast; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Targeted downregulation of overexpressed FTL protein by microRNA miR-133a increases the sensitivity of drug-resistant cells to doxorubicin and cisplatin.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/DOX cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: CVCL_4V97; Breast; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Targeted downregulation of overexpressed FTL protein by microRNA miR-133a increases the sensitivity of drug-resistant cells to doxorubicin and cisplatin.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [4]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High expression of miR-942, miR-628-5p, miR-133a, and miR-484 was significantly associated with decreased time to progression and overall survival. These microRNAs were also overexpressed in the sunitinib resistant cell line Caki-2 in comparison with the sensitive cell line.

References

• Ref 1: miR-133a enhances the sensitivity of Hep-2 cells and vincristine-resistant Hep-2v cells to cisplatin by downregulating ATP7B expression. Int J Mol Med. 2016 Jun;37(6):1636-42. doi: 10.3892/ijmm.2016.2569. Epub 2016 Apr 20.
• Ref 2: MicroRNA 133a and microRNA 326 co contribute to hepatocellular carcinoma 5 fluorouracil and cisplatin sensitivity by directly targeting B cell lymphoma extra large. Mol Med Rep. 2015 Oct;12(4):6235-40. doi: 10.3892/mmr.2015.4134. Epub 2015 Jul 29.
• Ref 3: Iron metabolism disturbances in the MCF-7 human breast cancer cells with acquired resistance to doxorubicin and cisplatin. Int J Oncol. 2013 Nov;43(5):1481-6. doi: 10.3892/ijo.2013.2063. Epub 2013 Aug 20.
• Ref 4: Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. doi: 10.1371/journal.pone.0086263. eCollection 2014.