Molecule Information

General Information of the Molecule (ID: Mol01420)

• Name: hsa-mir-132 ,Homo sapiens
• Synonyms: microRNA 132
• Molecule Type: Precursor miRNA
• Gene Name: MIR132
• Gene ID: 406921
• Location: chr17:2049908-2050008[-]
• Sequence:
  CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUA
  ACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC
• Ensembl ID: ENSG00000267200
• HGNC ID: HGNC:31516
• Precursor Accession: MI0000449

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ABCG2 signaling pathway; Activation; hsa02010
• Cell Pathway Regulation: SIRT1/CREB/ABCG2 signaling pathway; Regulation; hsa05200
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Upregulated miR132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. The expression of miR132 was inversely correlated with SIRT1 in gastric cancer specimens. Down-regulation of SIRT1 led to a subsequent increase of the level of acetylated CREB which in turn activated the ABCG2 signaling pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [2]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-132 can restore cisplatin treatment response in cisplatin-resistant xenografts in vivo, while FOXA1 protein levels were decreased.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/NF-kappaB signaling pathway; Regulation; hsa05235
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [4]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vitro Model: U87MG-res cells; Brain; Homo sapiens (Human); CVCL_GP63
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Soft agar assay; MTT assay; Sphere formation assay
• Mechanism Description: microRNA-132 induces temozolomide resistance and promotes the formation of cancer stem cell phenotypes by targeting tumor suppressor candidate 3 in glioblastoma.

References

• Ref 1: Upregulated miR-132 in Lgr5(+) gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. Mol Carcinog. 2017 Sep;56(9):2022-2034. doi: 10.1002/mc.22656. Epub 2017 May 2.
• Ref 2: MicroRNA-132 sensitizes nasopharyngeal carcinoma cells to cisplatin through regulation of forkhead box A1 protein. Pharmazie. 2016 Dec 1;71(12):715-718. doi: 10.1691/ph.2016.6764.
• Ref 3: MicroRNA-132 and microRNA-212 mediate doxorubicin resistance by down-regulating the PTEN-AKT/NF-kB signaling pathway in breast cancer. Biomed Pharmacother. 2018 Jun;102:286-294. doi: 10.1016/j.biopha.2018.03.088. Epub 2018 Mar 22.
• Ref 4: MicroRNA-132 induces temozolomide resistance and promotes the formation of cancer stem cell phenotypes by targeting tumor suppressor candidate 3 in glioblastoma. Int J Mol Med. 2017 Nov;40(5):1307-1314. doi: 10.3892/ijmm.2017.3124. Epub 2017 Sep 7.