Molecule Information

General Information of the Molecule (ID: Mol01414)

• Name: hsa-mir-122 ,Homo sapiens
• Synonyms: microRNA 122
• Molecule Type: Precursor miRNA
• Gene Name: MIR122
• Gene ID: 406906
• Location: chr18:58451074-58451158[+]
• Sequence:
  CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUA
  UCACACUAAAUAGCUACUGCUAGGC
• Ensembl ID: ENSG00000284440
• HGNC ID: HGNC:31501
• Precursor Accession: MI0000442

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow Cytometric Analysis
• Mechanism Description: Transfection of miR122 mimics into cultured HepG2 cells induces cell-cycle arrest and sensitizes these cells to doxorubicin by modulating the expression of multidrug resistance genes, ABCB1 and ABCF2.

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR122/PKM2 signaling pathway; Regulation; hsa05206
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-122 in Huh7/R cells reversed the doxorubicin-resistance through the inhibition of PkM2, inducing the apoptosis in doxorubicin-resistant cancer cells.

Disease Class: Hepatocellular carcinoma [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1.

Disease Class: Hepatocellular cancer [4]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V/propidium iodide detection kit
• Mechanism Description: miR-122 enforced expression, as well as cyclin G1 silencing, leads to increased p53 protein stability and transcriptional activity and reduced invasion capability of HCC-derived cell lines, miR-122, through down-regulation of cyclin G1, can trigger apoptosis and increase sensitivity of HCC-derived cells to doxorubicin.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatic carcinoma [5]

• Resistant Disease: Hepatic carcinoma [ICD-11: 2C12.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR122/PCDH20/AKT/mTOR signaling pathway; Activation; hsa05206
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: MHCC97 cells; Liver; Homo sapiens (Human); CVCL_4971
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; RT-qPCR
• Experiment for Drug Resistance: MTT assay; CellTiter 96 Aqueous One Solution cell proliferation assay
• Mechanism Description: Targeting PCDH20 gene by microRNA-122 confers 5-FU resistance in hepatic carcinoma. Rescue of PCDH20 expression in miR122-expressing cells decreases Akt and mTOR phosphorylation, re-sensitizing hepatocellular carcinoma cell to 5-fluorouracil induced apoptosis.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [6]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-122 inhibits MDR1 expression via suppression of Wnt/beta-catenin pathway, thereby enhancing HCC sensitivity to OXA.

Disease Class: Colorectal cancer [7]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The recovery of miR-122 expression can sensitize SW480/OR and HT29/OR cells to oxaliplatin-mediated apoptosis through the inhibition of XIAP expression.

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vivo Model: DEN-HCC mouse model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-122 overexpression increased sorafenib sensitivity in treated cells via downregulating SerpinB3 expression.

Disease Class: Hepatocellular carcinoma [9]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: RAS/RAF/ERK signaling pathway; Inhibition; hsa04010
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: T1115 cells; Liver; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-122 made drug-tolerant cells sensitive to sorafenib and induced apoptosis. Insulin-like growth factor 1 receptor (IGF-1R) was validated as a target of miR-122 and was repressed by this miRNA. miR-122-induced apoptosis was repressed by the IGF-1R activator IGFI or IGFII. Conversely, the IGF-1R inhibitor PPP or NVP-AEW541 in combination with sorafenib significantly induced cell apoptosis and disrupted tolerance to drugs in vitro. These results indicated that activation of IGF-1R by ectopic down-regulation of miR-122 counteracted the effects of sorafenib-induced apoptosis, thus conferring sorafenib resistance.

Disease Class: Hepatocellular carcinoma [10]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Angiogenic potential; Inhibition; hsa04370
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Tumorigenic properties; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: ADAM10 (a distintegrin and metalloprotease family), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and Sk-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [11]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V staining assay
• Mechanism Description: PED/PEA-15 has a broad antiapoptotic action, being able to inhibit both the intrinsic and the extrinsic apoptotic pathways. miR-212 negatively modulates PED/PEA-15 expression and sensitizes non-small cell lung cancer (NSCLC) cells to TRAIL-induced apoptosis.

References

• Ref 1: Possible Role of microRNA-122 in Modulating Multidrug Resistance of Hepatocellular Carcinoma. Indian J Clin Biochem. 2018 Jan;33(1):21-30. doi: 10.1007/s12291-017-0651-8. Epub 2017 Apr 21.
• Ref 2: MiR-122 Reverses the Doxorubicin-Resistance in Hepatocellular Carcinoma Cells through Regulating the Tumor Metabolism. PLoS One. 2016 May 3;11(5):e0152090. doi: 10.1371/journal.pone.0152090. eCollection 2016.
• Ref 3: MicroRNA-122 sensitizes HCC cancer cells to adriamycin and vincristine through modulating expression of MDR and inducing cell cycle arrest. Cancer Lett. 2011 Nov 28;310(2):160-9. doi: 10.1016/j.canlet.2011.06.027. Epub 2011 Jul 2.
• Ref 4: MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2009 Jul 15;69(14):5761-7. doi: 10.1158/0008-5472.CAN-08-4797. Epub 2009 Jul 7.
• Ref 5: Targeting PCDH20 gene by microRNA-122 confers 5-FU resistance in hepatic carcinoma. Am J Cancer Res. 2016 Aug 1;6(8):1681-94. eCollection 2016.
• Ref 6: miR-122 enhances sensitivity of hepatocellular carcinoma to oxaliplatin via inhibiting MDR1 by targeting Wnt/Beta-catenin pathway. Exp Mol Pathol. 2019 Feb;106:34-43. doi: 10.1016/j.yexmp.2018.10.009. Epub 2018 Oct 26.
• Ref 7: miR-122 Targets X-Linked Inhibitor of Apoptosis Protein to Sensitize Oxaliplatin-Resistant Colorectal Cancer Cells to Oxaliplatin-Mediated Cytotoxicity. Cell Physiol Biochem. 2018;51(5):2148-2159. doi: 10.1159/000495832. Epub 2018 Dec 6.
• Ref 8: MiR-122 Targets SerpinB3 and Is Involved in Sorafenib Resistance in Hepatocellular Carcinoma. J Clin Med. 2019 Feb 1;8(2):171. doi: 10.3390/jcm8020171.
• Ref 9: MicroRNA-122 confers sorafenib resistance to hepatocellular carcinoma cells by targeting IGF-1R to regulate RAS/RAF/ERK signaling pathways. Cancer Lett. 2016 Feb 28;371(2):171-81. doi: 10.1016/j.canlet.2015.11.034. Epub 2015 Dec 3.
• Ref 10: MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27. doi: 10.1074/jbc.M109.016774. Epub 2009 Sep 2.
• Ref 11: miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED. Cancer Res. 2010 May 1;70(9):3638-46. doi: 10.1158/0008-5472.CAN-09-3341. Epub 2010 Apr 13.