Molecule Information

General Information of the Molecule (ID: Mol01411)

• Name: hsa-mir-23b ,Homo sapiens
• Synonyms: microRNA 23b
• Molecule Type: Precursor miRNA
• Gene Name: MIR23B
• Gene ID: 407011
• Location: chr9:95085208-95085304[+]
• Sequence:
  CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUC
  ACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC
• Ensembl ID: ENSG00000207563
• HGNC ID: HGNC:31606
• Precursor Accession: MI0000439

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrial carcinoma [1]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEC1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vitro Model: Human normal endometrial epithelial cell line; Uterus; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RNA pull-down assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.

Disease Class: Chondrosarcoma [2]

• Sensitive Disease: Chondrosarcoma [ICD-11: 2B50.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Src/AKT signaling pathway; Inhibition; hsa04917
• In Vitro Model: CH-2879 cells; Bone; Homo sapiens (Human); CVCL_9921
• In Vitro Model: OUMS-27 cells; Bone; Homo sapiens (Human); CVCL_3090
• In Vitro Model: SW1353 cells; Bone; Homo sapiens (Human); CVCL_0543
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell invasion assay
• Mechanism Description: Src kinase is a direct target of miR23b in chondrosarcoma cells, overexpression of miR23b suppresses Src-Akt pathway, leading to the sensitization of cisplatin resistant chondrosarcoma cells to cisplatin.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrial carcinoma [1]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEC1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vitro Model: Human normal endometrial epithelial cell line; Uterus; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RNA pull-down assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Long non-coding RNA TUSC7 acted as a potential tumor suppressor gene to inhibit cell growth as well as advance the chemotherapy sensitivity through targeted silencing of miR23b.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [3]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: U87 GSCs; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-23b overexpression sensitized U87 glioma stem cells to TMZ-induced growth inhibition. And miR-23b had a synergistically suppressive effect on the expression of HMGA2 with TMZ in U87 GSCs.

References

• Ref 1: Long non-coding RNA tumor suppressor candidate 7 advances chemotherapy sensitivity of endometrial carcinoma through targeted silencing of miR-23b. Tumour Biol. 2017 Jun;39(6):1010428317707883. doi: 10.1177/1010428317707883.
• Ref 2: Inhibition of Src by microRNA-23b increases the cisplatin sensitivity of chondrosarcoma cells. Cancer Biomark. 2017;18(3):231-239. doi: 10.3233/CBM-160102.
• Ref 3: Methylation mediated silencing of miR-23b expression and its role in glioma stem cells. Neurosci Lett. 2012 Oct 24;528(2):185-9. doi: 10.1016/j.neulet.2012.08.055. Epub 2012 Sep 5.