Molecule Information

General Information of the Molecule (ID: Mol01407)

• Name: hsa-mir-200b ,Homo sapiens
• Synonyms: microRNA 200b
• Molecule Type: Precursor miRNA
• Gene Name: MIR200B
• Gene ID: 406984
• Location: chr1:1167104-1167198[+]
• Sequence:
  CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAU
  ACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG
• Ensembl ID: ENSG00000207730
• HGNC ID: HGNC:31579
• Precursor Accession: MI0000342

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 11 drug(s) in total

Cetuximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [1]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EGFR signaling pathway; Regulation; hsa01521
• In Vitro Model: 253J BV cells; Bladder; Homo sapiens (Human); CVCL_7937
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Pulse-labeling cells with [3H]thymidine
• Mechanism Description: Members of the miR-200 family appear to control the EMT process and sensitivity to EGFR therapy, in bladder cancer cells and that expression of miR-200 is sufficient to restore EGFR dependency, at least in some of the mesenchymal bladder cancer cells. The targets of miR-200 include ERRFI-1, which is a novel regulator of EGFR-independent growth.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [2]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Endometrial cancer [2]

• Resistant Disease: Endometrial cancer [ICD-11: 2C76.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Gastric adenocarcinoma [3]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Tongue cancer [4]

• Resistant Disease: Tongue cancer [ICD-11: 2B62.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: SHH/GLI1 signaling pathway; Activation; hsa05217
• In Vitro Model: CAL27 cells; Oral; Homo sapiens (Human); CVCL_1107
• In Vitro Model: SCC25 cells; Oral; Homo sapiens (Human); CVCL_1682
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of BMI1 alters cell proliferation, apoptosis and stem cell self-renewal and correlates with the invasion and metastasis of several human cancers. BMI1 overexpression due to reduction of miR-200b and miR-15b may result in chemotherapy-induced EMT in TSCCs via these pathways.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: HIOSE-80 cells; Ovary; Homo sapiens (Human); CVCL_E274
• In Vitro Model: OV119 cells; Ovary; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-200b- and miR-200c-mediated downregulation of DNMTs may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung small cell carcinoma [6]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: NCI-H69 cells; Lung; Homo sapiens (Human); CVCL_1579
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-200b was down-regulated in the resistant cells and enforced expression of miR-200b by miRNA mimics increased cell sensitivity. Overexpression of miR-200b led to the downregulation of ZEB2 at protein level. Luciferase reporter gene assay showed that 3'UTR ZEB2 activity was regulated by miR-200b. ZEB2 modulates drug resistance and is regulated by miR-200b. knockdown of ZEB2 increased cell sensitivity through increasing drug-induced cell apoptosis accompanied with S phase arrest. ZEB2 was regulated by miR-200b at protein level.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [7]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [8]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: HDAC1/4/Sp1/miR200b/E2F3 signaling pathway; Inhibition; hsa05206
• In Vitro Model: H1299/DTX cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: SPC-A1/DTX cells; Lung; Homo sapiens (Human); CVCL_W217
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Histone deacetylase (HDAC) inhibitors could restore the expression of miR-200b and reverse chemoresistant phenotypes of docetaxel-resistant LAD cells. HDAC1/4 repression significantly increased miR-200b expression by upregulating histone-H3 acetylation level at the two miR-200b promoters partially via a Sp1-dependent pathway. Furthermore, silencing of HDAC1/4 suppressed cell proliferation, promoted cell apoptosis, induced G2/M cell cycle arrest and ultimately reversed in vitro and in vivo chemoresistance of docetaxel-resistant LAD cells, at least partially in a miR-200b-dependent manner. HDAC1/4 suppression-induced rescue of miR-200b contributed to downregulation of E2F3, survivin and Aurora-A, and upregulation of cleaved-caspase-3. HDAC1/4 levels in docetaxel-insensitive human LAD tissues, inversely correlated with miR-200b, were upregulated compared with docetaxel-sensitive tissues. Taken together, our findings suggest that the HDAC1/4/Sp1/miR-200b/E2F3 pathway is responsible for chemoresistance of docetaxel-resistant LAD cells.

Disease Class: Prostate cancer [9]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Bmi-1 is expressed at a high level in PCa. miR-200b plays a pivotal role in PCa at least in part via downregulation of the oncogene Bmi-1, inhibition of Bmi-1 enhanced the antitumor activity of docetaxel in PCa cells.

Disease Class: Lung adenocarcinoma [10]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: E2F3 was generally considered to increase cellular proliferation as a transcriptional activator through the G1/S transition, down-regulation of miR-200b could lead to E2F3 overexpression and in turn contribute to chemoresistance of lung adenocarcinoma cells to docetaxel.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [11]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: MCF-10-2A cells; Breast; Homo sapiens (Human); CVCL_3743
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-blue cell viability assay
• Mechanism Description: The up-regulation of the miR-200b and miR-200c diminishes EMT by directly targeting the transcriptional repressor ZEB1 leading to up-regulation of E-cadherin. Restoration of E-cadherin expression increases the sensitivity of cancer cells to chemotherapeutic agents. Disruption of ZEB1-histone deacetylase repressor complexes and down-regulation of histone deacetylase, in particular SIRT1, positively affect the p53 apoptotic pathway leading to the increased sensitivity of breast cancer cells to chemotherapy and radiotherapy.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [12]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Hedgehog signaling pathway; Inhibition; hsa04340
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-200b and let-7c, inhibited the TGF-beta1-mediated resistance of NSCLC cells to erlotinib.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [13]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Disease Class: Bladder cancer [13]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cholangiocarcinoma [14]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: QBC939 cells; Bile duct; Homo sapiens (Human); CVCL_6942
• In Vitro Model: TFk-1 cells; Bile duct; Homo sapiens (Human); CVCL_2214
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: WST cell counting kit-8
• Mechanism Description: miR-200b/c influenced the tumourigenesis of cholangiocarcinoma cells including their tumour-initiating capacity, sphere formation, and drug resistance (like fluorouracil). We further found that miR-200b/c regulated migration and invasion capacities by directly targeting rho-kinase 2 and regulated tumorigenic properties by directly targeting SUZ12 (a subunit of a polycomb repressor complex).

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic carcinoma [15]

• Sensitive Disease: Pancreatic carcinoma [ICD-11: 2C10.2]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell metastasis; Inhibition; hsa05205
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Chemosensitivity; Activation; hsa05207
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Colorimetric methylene blue assay; Flow cytometry assay
• Mechanism Description: Forced expression of miR-200b induces CDH1 expression and promotes gemcitabine sensitivity in Capan-2 and Panc-1 cells.

Disease Class: Cholangiocarcinoma [16]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: KMCH-1 cells; Gallbladder; Homo sapiens (Human); CVCL_7970
• In Vitro Model: Mz-ChA-1 cells; Gallbladder; Homo sapiens (Human); CVCL_6932
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Northern blotting analysis
• Experiment for Drug Resistance: Celltiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: PTPN12 can bind and dephosphorylate the product ofoncogenes such as c-Abl or Src and inactivate the Raspathway. Thus, deregulation of PTPN12 expressionmay contribute to tumor cell survival and oncogenesis. In cells transfected with anti-miR-200b, PTPN12 ex-pression was increased to 132.2%+/-7.2% of controlafter 48 hours and 147.3%+/-12.8% of control after 72hours. Moreover, inhibition of miR-200b significantlyreduced the tyrosine phosphorylation of a downstreamtarget Src, a key mediator of tumor cell proliferation anddifferentiation.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [17]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Re-expression of miR-200 in gemcitabine-resistant cells showed partial reversal of EMT characteristics as documented by increased expression of E-cadherin and decreased expression of vimentin, ZEB1, and slug. These results suggest that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin and that the re-expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-epithelial transition (MET). re-expression of miR-200 by transfection studies or treatment of gemcitabine-resistant cells with either DIM or isoflavone resulted in the down-regulation of ZEB1, slug, and vimentin, which was consistent with morphological reversal of EMT phenotype leading to epithelial morphology.

Intedanib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [18]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Intedanib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• In Vitro Model: EBC-1 cells; Lung; Homo sapiens (Human); CVCL_2891
• In Vitro Model: LC-1/sq cells; Lung; Homo sapiens (Human); CVCL_3008
• In Vitro Model: LC-2/ad cells; Lung; Homo sapiens (Human); CVCL_1373
• In Vitro Model: Lk-2 cells; Lung; Homo sapiens (Human); CVCL_1377
• In Vitro Model: NCI-HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC-1 cells; Pancreas; Homo sapiens (Human); CVCL_S978
• In Vitro Model: PC-10 cells; Lung; Homo sapiens (Human); CVCL_7088
• In Vitro Model: QG56 cells; Lung; Homo sapiens (Human); CVCL_6943
• In Vitro Model: RERF-LCkJ cells; Lung; Homo sapiens (Human); CVCL_1654
• In Vitro Model: SQ5 cells; Lung; Homo sapiens (Human); CVCL_8273
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Melanoma [19]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric adenocarcinoma [3]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Curcumin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [20]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Curcumin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HepJ5 cells; Liver; Homo sapiens (Human); CVCL_RW48
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression ofmiR-200a/b in HepJ5 cells conferred enhanced resistance tocurcumin treatment compared with the control cells.

Investigative Drug(s) 1 drug(s) in total

Celastrol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Melanoma [19]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Celastrol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.

Disease- and Tissue-specific Abundances of This Molecule

ICD Disease Classification 02

Gastric cancer [ICD-11: 2B72]

Differential expression of molecule in resistant diseases

• The Studied Tissue: Stomach
• The Specified Disease: Stomach adenocarcinoma
• The Expression Level of Disease Section Compare with the Healthy Individual Tissue: p-value: 4.93E-04; Fold-change: 1.65E-01

References

• Ref 1: miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res. 2009 Aug 15;15(16):5060-72. doi: 10.1158/1078-0432.CCR-08-2245. Epub 2009 Aug 11.
• Ref 2: A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
• Ref 3: miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
• Ref 4: MiR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene. 2012 Jan 26;31(4):432-45. doi: 10.1038/onc.2011.263. Epub 2011 Jul 4.
• Ref 5: miR-200b and miR-200c co-contribute to the cisplatin sensitivity of ovarian cancer cells by targeting DNA methyltransferases. Oncol Lett. 2019 Feb;17(2):1453-1460. doi: 10.3892/ol.2018.9745. Epub 2018 Nov 22.
• Ref 6: Zinc finger E-box-binding homeobox 2 (ZEB2) regulated by miR-200b contributes to multi-drug resistance of small cell lung cancer. Exp Mol Pathol. 2014 Jun;96(3):438-44. doi: 10.1016/j.yexmp.2014.04.008. Epub 2014 Apr 22.
• Ref 7: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 8: HDAC 1/4-mediated silencing of microRNA-200b promotes chemoresistance in human lung adenocarcinoma cells. Oncotarget. 2014 May 30;5(10):3333-49. doi: 10.18632/oncotarget.1948.
• Ref 9: miR-200b suppresses cell proliferation, migration and enhances chemosensitivity in prostate cancer by regulating Bmi-1. Oncol Rep. 2014 Feb;31(2):910-8. doi: 10.3892/or.2013.2897. Epub 2013 Dec 5.
• Ref 10: MicroRNA-200b reverses chemoresistance of docetaxel-resistant human lung adenocarcinoma cells by targeting E2F3. Cancer. 2012 Jul 1;118(13):3365-76. doi: 10.1002/cncr.26560. Epub 2011 Dec 2.
• Ref 11: E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cells. Int J Cancer. 2010 Jun 1;126(11):2575-83. doi: 10.1002/ijc.24972.
• Ref 12: Inhibition of Hedgehog signaling sensitizes NSCLC cells to standard therapies through modulation of EMT-regulating miRNAs. J Hematol Oncol. 2013 Oct 7;6(1):77. doi: 10.1186/1756-8722-6-77.
• Ref 13: The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
• Ref 14: Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104. doi: 10.1038/bjc.2013.655. Epub 2013 Oct 29.
• Ref 15: MicroRNA-200b and -301 are associated with gemcitabine response as biomarkers in pancreatic carcinoma cells. Int J Oncol. 2019 Mar;54(3):991-1000. doi: 10.3892/ijo.2019.4676. Epub 2019 Jan 7.
• Ref 16: Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29. doi: 10.1053/j.gastro.2006.02.057.
• Ref 17: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
• Ref 18: miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. Int J Oncol. 2016 Mar;48(3):937-44. doi: 10.3892/ijo.2016.3331. Epub 2016 Jan 11.
• Ref 19: miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
• Ref 20: MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 2013 Oct;34(5):3209-18. doi: 10.1007/s13277-013-0891-z. Epub 2013 Jun 13.