Molecule Information

General Information of the Molecule (ID: Mol01404)
Name
hsa-mir-222 ,Homo sapiens
Synonyms
microRNA 222
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR222
Gene ID
407007
Location
chrX:45747015-45747124[-]
Sequence
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCG
UAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU
    Click to Show/Hide
Ensembl ID
ENSG00000207725
HGNC ID
HGNC:31602
Precursor Accession
MI0000299
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [1]
Sensitive Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model UM1 cells Tongue Homo sapiens (Human) CVCL_VH00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Antisense (As)-miR-222 inhibits the expression of miR-222. In contrast, PUMA was dramaticallyup-regulated. IC50 values were significantly decreased in cells treated with As-miR-222 combined with CDDP, to a greater extent than in cells treated with CDDP alone. Furthermore, As-miR-222 (+) apoptosis and inhibited the invasiveness of UM1 cells. Analysis of the above data suggested that, in UM1 cells, there might be a regulatory loop between miR-222 and PUMA, and that miR-222 inhibition increased the chemosensitivity to CDDP.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [3]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Bim signaling pathway Activation hsa05206
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-222 promotes drug resistance to doxorubicin in breast cancer via regulation of miR-222/bim pathway.
Disease Class: Breast cancer [4], [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PTEN/AKT/FOXO1 signaling pathway Inhibition hsa05235
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
MCF-7/S cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Annexin-V-APC apoptosis assay; Flow cytometry assay
Mechanism Description miR222 promotes drug-resistance of breast cancer cells to adriamycin via modulation of PTEN/Akt/FOXO1 pathway, inhibition of miR222 resulted in increased PTEN expression and decreased p-Akt expression. The expression of miR222 is negatively correlated with FOXO1 expression in breast cancer cells. Inhibition of miR222 could reverse the ADR-resistance and improve the prognosis of breast cancer patients.
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-222 induced Adr-resistance at least in part via suppressing p27kip1 expression and altering its subcellular localization, and miR-222 inhibitors could reverse Adr-resistance of breast cancer cells.
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [7]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [7]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [8]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Regulation hsa04151
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HL-7702 cells Liver Homo sapiens (Human) CVCL_6926
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR 222 facilitate sorafenib resistance and enhance tumorigenicity in hepatocellular carcinoma.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [9]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Ectopic expression of miR-221/222 rendered the parental MCF-7 cells resistant to tamoxifen. The protein level of the cell cycle inhibitor p27kip1, a known target of miR-221/222, was reduced by 50% in OHTR cells and by 28-50% in miR-221/222-overexpressing MCF-7 cells. Furthermore, overexpression of p27kip1 in the resistant OHTR cells caused enhanced cell death when exposed to tamoxifen.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [10]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-8 assay
Mechanism Description Transfection of AS-miR-221 and AS-miR-222 dramatically inhibited expression of miR-221 and miR-222, respectively, in both MCF-7 and MDA-MB-231 cells (P<0.05-0.01). Down-regulation of miR-221/222 significantly increased the expression of TIMP3 compared with controls (P<0.05-0.01). The viability of estrogen receptor (ER)-positive MCF-7 cells transfected with AS-miR-221 or/and AS-miR-222 was significantly reduced by tamoxifen (P<0.05-0.01). Suppression of miRNA-221/222 increases the sensitivity of ER-positive MCF-7 breast cancer cells to tamoxifen. This effect is mediated through upregulation of TIMP3. These findings suggest that upregulation of TIMP3 via inhibition of miRNA-221/222 could be a promising therapeutic approach for breast cancer.
Disease Class: Breast cancer [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT474 cells Breast Homo sapiens (Human) CVCL_0179
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-157 cells Breast Homo sapiens (Human) CVCL_0618
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
MDA-MB-435s cells Breast Homo sapiens (Human) CVCL_0622
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-221 and miR-222 are frequently up-regulated in ERalpha-negative breast cancer cell lines and primary tumors. The elevated level of miR-221 and miR-222 is responsible for a subset of ERalpha-negative breast tumors that express ERalpha mRNA. Furthermore, overexpression of miR-221 and miR-222 contributes to tamoxifen resistance through negative regulation of ERalpha, whereas knockdown of miR-221 and/or miR-222 restores ERalpha expression and tamoxifen sensitivity.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [7]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [12]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug TRAIL
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
TRAIL signaling pathway Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
Experiment for
Molecule Alteration		 qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of kit and p27kip1 mRNAs, but interfere with TRAIL signaling mainly through p27kip1. miR-221 and -222 modulate TRAIL sensitivity in lung cancer cells mainly by modulating p27kip1 expression and TRAIL-induced caspase machinery.
References
Ref 1 MiR-222 targeted PUMA to improve sensitization of UM1 cells to cisplatin. Int J Mol Sci. 2014 Dec 2;15(12):22128-41. doi: 10.3390/ijms151222128.
Ref 2 MiR-222 and miR-29a contribute to the drug-resistance of breast cancer cells. Gene. 2013 Nov 15;531(1):8-14. doi: 10.1016/j.gene.2013.08.062. Epub 2013 Aug 29.
Ref 3 MicroRNA-222 promotes drug resistance to doxorubicin in breast cancer via regulation of miR-222/bim pathway. Biosci Rep. 2019 Jul 15;39(7):BSR20190650. doi: 10.1042/BSR20190650. Print 2019 Jul 31.
Ref 4 miR-222 induces Adriamycin resistance in breast cancer through PTEN/Akt/p27(kip1) pathway. Tumour Biol. 2016 Nov;37(11):15315-15324. doi: 10.1007/s13277-016-5341-2. Epub 2016 Oct 4.
Ref 5 MiR-222 promotes drug-resistance of breast cancer cells to adriamycin via modulation of PTEN/Akt/FOXO1 pathway. Gene. 2017 Jan 5;596:110-118. doi: 10.1016/j.gene.2016.10.016. Epub 2016 Oct 13.
Ref 6 miR-222 confers the resistance of breast cancer cells to Adriamycin through suppression of p27(kip1) expression. Gene. 2016 Sep 15;590(1):44-50. doi: 10.1016/j.gene.2016.06.013. Epub 2016 Jun 6.
Ref 7 MiR-222 modulates multidrug resistance in human colorectal carcinoma by down-regulating ADAM-17. Exp Cell Res. 2012 Oct 15;318(17):2168-77. doi: 10.1016/j.yexcr.2012.04.014. Epub 2012 Jun 4.
Ref 8 miR 222 regulates sorafenib resistance and enhance tumorigenicity in hepatocellular carcinoma. Int J Oncol. 2014 Oct;45(4):1537-46. doi: 10.3892/ijo.2014.2577. Epub 2014 Aug 4.
Ref 9 MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.
Ref 10 Downregulation of miR-221/222 enhances sensitivity of breast cancer cells to tamoxifen through upregulation of TIMP3. Cancer Gene Ther. 2014 Jul;21(7):290-6. doi: 10.1038/cgt.2014.29. Epub 2014 Jun 13.
Ref 11 MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem. 2008 Nov 7;283(45):31079-86. doi: 10.1074/jbc.M806041200. Epub 2008 Sep 12.
Ref 12 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55. doi: 10.1038/onc.2008.6. Epub 2008 Feb 4.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.