Molecule Information

General Information of the Molecule (ID: Mol01401)
Name
hsa-mir-218 ,Homo sapiens
Synonyms
microRNA 218-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR218-1
Gene ID
407000
Location
chr4:20528275-20528384[+]
Sequence
GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGA
GUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
    Click to Show/Hide
Ensembl ID
ENSG00000207732
HGNC ID
HGNC:31595
Precursor Accession
MI0000294
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral cancer [1]
Resistant Disease Oral cancer [ICD-11: 2B6E.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PPP2R5A/Wnt signaling pathway Regulation hsa04310
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
CAL27 cells Oral Homo sapiens (Human) CVCL_1107
SCC25 cells Oral Homo sapiens (Human) CVCL_1682
SCC9 cells Tongue Homo sapiens (Human) CVCL_1685
MDA-1386Ln cells Tongue Homo sapiens (Human) CVCL_H541
SCC15 cells Tongue Homo sapiens (Human) CVCL_1681
UM1 cells Tongue Homo sapiens (Human) CVCL_VH00
UM2 cells Tongue Homo sapiens (Human) CVCL_VH01
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description microRNA-218 promotes cisplatin resistance in oral cancer via the PPP2R5A/Wnt signaling pathway. Suppression of miR218 or PPP2R5A significantly promoted or reduced cisplatin-induced apoptosis, respectively. PPP2R5A overexpression or beta-catenin knockdown inhibited miR218-mediated Wnt activation and partially restored cell sensitivity.
Disease Class: Prostate cancer [2]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell viability Activation hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration		 PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometric analysis
Mechanism Description Overexpression of miR218 inhibited cell viability, migration, and invasion in PC3 and DU145 cells. Overexpression of BCAT1 decreased the chemosensitivity to CDDP treatment of PC3 and DU145 cells. The tumor suppressive role of miR218 was mediated by negatively regulating BCAT1 protein expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR218-Glut1 signaling pathway Regulation hsa05206
In Vitro Model EJ cells Bladder Homo sapiens (Human) CVCL_UI82
T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR218 increases the sensitivity of bladder cancer to cisplatin by targeting Glut1.
Disease Class: Gastric cancer [4]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
mTOR signaling pathway Regulation hsa04150
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST-1 kit assay
Mechanism Description miR-218 increased chemosensitivity of gastric cancer cells to cisplatin via its target mTOR inhibitor.
Disease Class: Cervical cancer [5]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/mTOR signaling pathway Inhibition hsa04150
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 PCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description Overexpression of miR-218 Inhibited Expression of Rictor, an mTOR Component, and Its Downstream Pathway, inhibited the proliferation of the human cervical cancer cell line HeLa and increased chemosensitivity to cisplatin in vitro by blocking the AkT-mTOR signaling pathway.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [7]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell metastasis Activation hsa05205
NF-kB signaling pathway Activation hsa04218
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
Experiment for
Molecule Alteration		 qRT-PCR; luciferase reporter assay;ChIP
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description HOTAIR contributes to 5FU resistance through suppressing miR-218 and activating NF-kB signaling in CRC.
Disease Class: Colorectal cancer [7]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation NF-kB signaling pathway Activation hsa04218
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
FHC cells Colon Homo sapiens (Human) CVCL_3688
Experiment for
Molecule Alteration		 qPCR; Western blot analysis
Experiment for
Drug Resistance		 CCK8 assay; Colony formation assays
Mechanism Description LncRNA HOTAIR contributes to 5fu resistance through suppressing miR-218 and activating NF-kB/TS signaling in colorectal cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
FHC cells Colon Homo sapiens (Human) CVCL_3688
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Boyden chambers cell migration and invasion assays
Mechanism Description miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5.
Leucovorin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Leucovorin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
FHC cells Colon Homo sapiens (Human) CVCL_3688
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Boyden chambers cell migration and invasion assays
Mechanism Description miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [9]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
HCT-116/L-OHP cells Kidney Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis of apoptosis
Mechanism Description Down-regulation of YEATS4 by miR218 sensitizes colorectal cancer cells to L-OHP-induced cell apoptosis by inhibiting cytoprotective autophagy.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
FHC cells Colon Homo sapiens (Human) CVCL_3688
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Boyden chambers cell migration and invasion assays
Mechanism Description miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5.
Sirolimus
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [10]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Sirolimus
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
mTOR signaling pathway Inhibition hsa04150
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
C33A cells Uterus Homo sapiens (Human) CVCL_1094
In Vivo Model Mouse bearing cervical cancer model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description microRNA-218 increases cellular sensitivity to Rapamycin via targeting Rictor and reducing the level of Rictor in cervical cancer.
References
Ref 1 MicroRNA-218 promotes cisplatin resistance in oral cancer via the PPP2R5A/Wnt signaling pathway. Oncol Rep. 2017 Oct;38(4):2051-2061. doi: 10.3892/or.2017.5899. Epub 2017 Aug 11.
Ref 2 MicroRNA-218 inhibits tumor growth and increases chemosensitivity to CDDP treatment by targeting BCAT1 in prostate cancer. Mol Carcinog. 2017 Jun;56(6):1570-1577. doi: 10.1002/mc.22612. Epub 2017 Jan 18.
Ref 3 MicroRNA-218 Increases the Sensitivity of Bladder Cancer to Cisplatin by Targeting Glut1. Cell Physiol Biochem. 2017;41(3):921-932. doi: 10.1159/000460505. Epub 2017 Feb 20.
Ref 4 MicroRNA-218 is upregulated in gastric cancer after cytoreductive surgery and hyperthermic intraperitoneal chemotherapy and increases chemosensitivity to cisplatin. World J Gastroenterol. 2014 Aug 28;20(32):11347-55. doi: 10.3748/wjg.v20.i32.11347.
Ref 5 MiR-218 impairs tumor growth and increases chemo-sensitivity to cisplatin in cervical cancer. Int J Mol Sci. 2012 Nov 28;13(12):16053-64. doi: 10.3390/ijms131216053.
Ref 6 MiR-218 inhibits multidrug resistance (MDR) of gastric cancer cells by targeting Hedgehog/smoothened. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6397-406. eCollection 2015.
Ref 7 lncRNA HOTAIR Contributes to 5FU Resistance through Suppressing miR-218 and Activating NF-kB/TS Signaling in Colorectal Cancer. Mol Ther Nucleic Acids. 2017 Sep 15;8:356-369. doi: 10.1016/j.omtn.2017.07.007. Epub 2017 Jul 8.
Ref 8 MALAT1 Is Associated with Poor Response to Oxaliplatin-Based Chemotherapy in Colorectal Cancer Patients and Promotes Chemoresistance through EZH2. Mol Cancer Ther. 2017 Apr;16(4):739-751. doi: 10.1158/1535-7163.MCT-16-0591. Epub 2017 Jan 9.
Ref 9 Downregulation of YEATS4 by miR-218 sensitizes colorectal cancer cells to L-OHP-induced cell apoptosis by inhibiting cytoprotective autophagy. Oncol Rep. 2016 Dec;36(6):3682-3690. doi: 10.3892/or.2016.5195. Epub 2016 Oct 21.
Ref 10 MicroRNA-218 increases cellular sensitivity to Rapamycin via targeting Rictor in cervical cancer. APMIS. 2015 Jul;123(7):562-70. doi: 10.1111/apm.12387. Epub 2015 Apr 24.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.