Molecule Information

General Information of the Molecule (ID: Mol01400)

• Name: hsa-mir-217 ,Homo sapiens
• Synonyms: microRNA 217
• Molecule Type: Precursor miRNA
• Gene Name: MIR217
• Gene ID: 406999
• Location: chr2:55982967-55983076[-]
• Sequence:
  AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAA
  GAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAG
• Ensembl ID: ENSG00000207548
• HGNC ID: HGNC:31594
• Precursor Accession: MI0000293

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-217 suppresses tumour development in lung cancer by targeting kRAS and enhances cell sensitivity to cisplatin.

Dasatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [2]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR217/AGR2 signaling pathway; Regulation; hsa05206
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: Ku812 cells; Bone marrow; Homo sapiens (Human); CVCL_0379
• In Vitro Model: kCL22 cells; Pleural effusion; Homo sapiens (Human); CVCL_2091
• In Vivo Model: NRG mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-217 sensitizes chronic myelogenous leukemia cells to tyrosine kinase inhibitors by downregulating pro-oncogenic anterior gradient 2.

Disease Class: Chronic myelogenous Ph(+) leukemia [3]

• Sensitive Disease: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1]
• Sensitive Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Bcr/Abl-expressing k562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562DR cells; Blood; Homo sapiens (Human); CVCL_4V59
• In Vitro Model: K562NR cells; Blood; Homo sapiens (Human); CVCL_4V63
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [4]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: microRNA 217 inhibits cell proliferation and enhances chemosensitivity to doxorubicin in acute myeloid leukemia by targeting kRAS.

Nilotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myelogenous Ph(+) leukemia [3]

• Sensitive Disease: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1]
• Sensitive Drug: Nilotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Bcr/Abl-expressing k562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562DR cells; Blood; Homo sapiens (Human); CVCL_4V59
• In Vitro Model: K562NR cells; Blood; Homo sapiens (Human); CVCL_4V63
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [5]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [6]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• Cell Pathway Regulation: TGF-beta signaling pathway; Activation; hsa04350
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HCCLM3 cells; Liver; Homo sapiens (Human); CVCL_6832
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: BEL-7404 cells; Liver; Homo sapiens (Human); CVCL_6568
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vitro Model: HLE cells; Liver; Homo sapiens (Human); CVCL_1281
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC.

Investigative Drug(s) 1 drug(s) in total

Celastrol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [5]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Celastrol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.

References

• Ref 1: MicroRNA-217 functions as a tumour suppressor gene and correlates with cell resistance to cisplatin in lung cancer. Mol Cells. 2014 Sep;37(9):664-71. doi: 10.14348/molcells.2014.0121. Epub 2014 Sep 18.
• Ref 2: miR-217 sensitizes chronic myelogenous leukemia cells to tyrosine kinase inhibitors by targeting pro-oncogenic anterior gradient 2. Exp Hematol. 2018 Dec;68:80-88.e2. doi: 10.1016/j.exphem.2018.09.001. Epub 2018 Sep 5.
• Ref 3: Downregulation of miR-217 correlates with resistance of Ph(+) leukemia cells to ABL tyrosine kinase inhibitors. Cancer Sci. 2014 Mar;105(3):297-307. doi: 10.1111/cas.12339. Epub 2014 Jan 30.
• Ref 4: MicroRNA 217 inhibits cell proliferation and enhances chemosensitivity to doxorubicin in acute myeloid leukemia by targeting KRAS. Oncol Lett. 2017 Jun;13(6):4986-4994. doi: 10.3892/ol.2017.6076. Epub 2017 Apr 24.
• Ref 5: miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
• Ref 6: MicroRNA-216a/217-induced epithelial-mesenchymal transition targets PTEN and SMAD7 to promote drug resistance and recurrence of liver cancer. Hepatology. 2013 Aug;58(2):629-41. doi: 10.1002/hep.26369. Epub 2013 Jun 25.