Molecule Information

General Information of the Molecule (ID: Mol01398)

• Name: hsa-mir-215 ,Homo sapiens
• Synonyms: microRNA 215
• Molecule Type: Precursor miRNA
• Gene Name: MIR215
• Gene ID: 406997
• Location: chr1:220117853-220117962[-]
• Sequence:
  AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAGCUGAGU
  UUGUCUGUCAUUUCUUUAGGCCAAUAUUCUGUAUGACUGUGCUACUUCAA
• Ensembl ID: ENSG00000207590
• HGNC ID: HGNC:31592
• Precursor Accession: MI0000291

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.

Raltitrexed

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Raltitrexed
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Raltitrexed
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-215, through the suppression of DTL expression, induces a decreased cell proliferation by causing G2-arrest, thereby leading to an increase in chemoresistance to MTX and TDX.

References

• Ref 1: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.