Molecule Information

General Information of the Molecule (ID: Mol01396)

• Name: hsa-mir-212 ,Homo sapiens
• Synonyms: microRNA 212
• Molecule Type: Precursor miRNA
• Gene Name: MIR212
• Gene ID: 406994
• Location: chr17:2050271-2050380[-]
• Sequence:
  CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGG
  CCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC
• Ensembl ID: ENSG00000267195
• HGNC ID: HGNC:31589
• Precursor Accession: MI0000288

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cetuximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [1]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SCC1 cells; Tongue; Homo sapiens (Human); CVCL_A5SA
• In Vitro Model: 1Cc8 cells; Epithelium; Homo sapiens (Human); CVCL_L893
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: HB-EGF can induce EMT, enhance metastasis, and modulate chemotherapy resistance. Increased expression of HB-EGF due to down-regulation of miR-212 is a possible mechanism of cetuximab resistance.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/NF-kappaB signaling pathway; Regulation; hsa05235
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level.

References

• Ref 1: Regulation of heparin-binding EGF-like growth factor by miR-212 and acquired cetuximab-resistance in head and neck squamous cell carcinoma. PLoS One. 2010 Sep 13;5(9):e12702. doi: 10.1371/journal.pone.0012702.
• Ref 2: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 3: MicroRNA-132 and microRNA-212 mediate doxorubicin resistance by down-regulating the PTEN-AKT/NF-kB signaling pathway in breast cancer. Biomed Pharmacother. 2018 Jun;102:286-294. doi: 10.1016/j.biopha.2018.03.088. Epub 2018 Mar 22.