Molecule Information

General Information of the Molecule (ID: Mol01395)

• Name: hsa-mir-211 ,Homo sapiens
• Synonyms: microRNA 211
• Molecule Type: Precursor miRNA
• Gene Name: MIR211
• Gene ID: 406993
• Location: chr15:31065032-31065141[-]
• Sequence:
  UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUCGCCUAGGGCUCUGAGCA
  GGGCAGGGACAGCAAAGGGGUGCUCAGUUGUCACUUCCCACAGCACGGAG
• Ensembl ID: ENSG00000207702
• HGNC ID: HGNC:31588
• Precursor Accession: MI0000287

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [1]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Methylation; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: Sk-Mel28 cells; Skin; Homo sapiens (Human); CVCL_0526
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpressed 211 could enhance the anticancer effect of cisplatin and restoration of miR-211 rendered susceptibility to cisplatin in cisplatin-resistant cells.miR-211 could be transcriptionally repressed by EZH2 mediated promoter methylation.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Transwell migration assay
• Mechanism Description: NEAT1 promoted invasion through inducing Epithelial-mesenchymal transition (EMT), NEAT1 down-regulation inhibited cell motility and invasion by reversing the EMT phenotype and increased breast cancer cells chemo-sensitivity. There may be a reciprocal repression between miR211 and NEAT1.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [3]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Suit2 cells; Pancreas; Homo sapiens (Human); CVCL_3172
• In Vitro Model: SUIT2-007 cells; Pancreas; Homo sapiens (Human); CVCL_B279
• In Vitro Model: SUIT2-028 cells; Pancreas; Homo sapiens (Human); CVCL_B282
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay
• Mechanism Description: The induction of the miR-211 expression in the cells increased the sensitivity to gemcitabine and reduced the expression of its target ribonucleotide reductase subunit 2 (RRM2).

References

• Ref 1: Methylation-Mediated Silencing of MicroRNA-211 Decreases the Sensitivity of Melanoma Cells to Cisplatin. Med Sci Monit. 2019 Mar 1;25:1590-1599. doi: 10.12659/MSM.911862.
• Ref 2: The lncRNA NEAT1 facilitates cell growth and invasion via the miR-211/HMGA2 axis in breast cancer. Int J Biol Macromol. 2017 Dec;105(Pt 1):346-353. doi: 10.1016/j.ijbiomac.2017.07.053. Epub 2017 Jul 16.
• Ref 3: miR-211 modulates gemcitabine activity through downregulation of ribonucleotide reductase and inhibits the invasive behavior of pancreatic cancer cells. Nucleosides Nucleotides Nucleic Acids. 2014;33(4-6):384-93. doi: 10.1080/15257770.2014.891741.