Molecule Information

General Information of the Molecule (ID: Mol01394)

• Name: hsa-mir-210 ,Homo sapiens
• Synonyms: microRNA 210
• Molecule Type: Precursor miRNA
• Gene Name: MIR210
• Gene ID: 406992
• Location: chr11:568089-568198[-]
• Sequence:
  ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAG
  ACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC
• Ensembl ID: ENSG00000199038
• HGNC ID: HGNC:31587
• Precursor Accession: MI0000286

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Daunorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [1]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Dexamethasone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [1]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Dexamethasone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [2]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Dual luciferase reporter assay
• Experiment for Drug Resistance: TUNEL Assay; MTT assay; Flow cytometric analysis
• Mechanism Description: LncRNA CTA-miR210 axis plays an important role in reducing OS chemoresistance. LncRNA CTA could be activated by doxorubicin (DOX), and could promote OS cell apoptosis by competitively binding miR210, while inhibit cell autophagy.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [3]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vivo Model: Chick egg xenograft model; Gallus gallus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: RealTime-Glo MT Cell Viability Assay; Caspase-3/7 substrate assay; Colony formation assay
• Mechanism Description: microRNA-210 overexpression inhibits tumor growth and potentially reverses gemcitabine resistance in pancreatic cancer, miR210 is a direct suppressor of the multidrug efflux transporter ABCC5.

L-asparaginase

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [1]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: L-asparaginase
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The function of miR-210, which is directly regulated by hypoxia-inducible factor 1-alpha, may also depend on cancer type. miR-210 inhibits apoptosis, bypasses cell-cycle arrest, and promotes cancer cell survival when overexpressed, but when underexpressed, as it is in esophageal squamous cell carcinoma, it represses the initiation of tumor growth by inducing cell death and cell-cycle arrest.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [1]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

References

• Ref 1: Effect of microRNA-210 on prognosis and response to chemotherapeutic drugs in pediatric acute lymphoblastic leukemia. Cancer Sci. 2014 Apr;105(4):463-72. doi: 10.1111/cas.12370. Epub 2014 Mar 30.
• Ref 2: Long non-coding RNA CTA sensitizes osteosarcoma cells to doxorubicin through inhibition of autophagy. Oncotarget. 2017 May 9;8(19):31465-31477. doi: 10.18632/oncotarget.16356.
• Ref 3: microRNA-210 overexpression inhibits tumor growth and potentially reverses gemcitabine resistance in pancreatic cancer. Cancer Lett. 2017 Mar 1;388:107-117. doi: 10.1016/j.canlet.2016.11.035. Epub 2016 Dec 7.
• Ref 4: Plasma microRNA 210 levels correlate with sensitivity to trastuzumab and tumor presence in breast cancer patients. Cancer. 2012 May 15;118(10):2603-14. doi: 10.1002/cncr.26565. Epub 2011 Oct 5.