Molecule Information

General Information of the Molecule (ID: Mol01388)

• Name: hsa-mir-183 ,Homo sapiens
• Synonyms: microRNA 183
• Molecule Type: Precursor miRNA
• Gene Name: MIR183
• Gene ID: 406959
• Location: chr7:129774905-129775014[-]
• Sequence:
  CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUC
  AGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCACGA
• Ensembl ID: ENSG00000207691
• HGNC ID: HGNC:31554
• Precursor Accession: MI0000273

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [1]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Tumorigenesis; Activation; hsa05206
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• In Vitro Model: C666-1 cells; Throat; Homo sapiens (Human); CVCL_7949
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: HONE1 cells; Throat; Homo sapiens (Human); CVCL_8706
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR183 overexpression inhibits tumorigenesis and enhances DDP-induced cytotoxicity by targeting MTA1 in nasopharyngeal carcinoma.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [2]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: ERK signaling pathway; Regulation; hsa04210
• Cell Pathway Regulation: RTK signaling pathway; Inhibition; hsa04015
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• Experiment for Molecule Alteration: Immunoblotting assay
• Experiment for Drug Resistance: MTT assay; Flow cytometer assay
• Mechanism Description: CASC2 directly targets miR183 to inhibit its expression. SPRY2 is regarded as a negative regulator RTk signaling pathway, antagonizing cell migration and/or cellular differentiation occurring through the ERk signaling. CASC2 competes with SPRY2 for miR183 binding to rescue the expression of SPRY2 in PC cells, thus suppressing the cell proliferation and promoting the apoptosis of PC cells, finally enhancing PC cells chemo-sensitivity to docetaxel through SPRY2 downstream ERk signaling pathway.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular cancer [3]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR183/IDH2/SOCS6/HIF1alpha feedback loop signaling pathway; Regulation; hsa05206
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: IDH2 knockdown resulted in significantly increased HIF-1alpha expression in both BEL-7402 and BEL-7402/5-FU cells. knockdown of SOCS6 had similar but stronger effect as miR-183 in promoting MRP2, P-gp, p-STAT3 and HIF-1alpha expression in BEL-7402 cells, while SOCS6 overexpression also showed similar but stronger effect as miR-183 inhibition in reducing MRP2, P-gp, p-STAT3 and HIF-1alpha levels in BEL-7402/5-FU cells. Both SOCS6 overexpression and miR-183 knockdown significantly increased the sensitivity of BEL-7402/5-FU cells to 5-FU. miR-183 overexpression partly abrogated the effect of SOCS6 in enhancing 5-FU sensitivity.

References

• Ref 1: MiR-183 overexpression inhibits tumorigenesis and enhances DDP-induced cytotoxicity by targeting MTA1 in nasopharyngeal carcinoma. Tumour Biol. 2017 Jun;39(6):1010428317703825. doi: 10.1177/1010428317703825.
• Ref 2: Long non-coding RNA CASC2 regulates Sprouty2 via functioning as a competing endogenous RNA for miR-183 to modulate the sensitivity of prostate cancer cells to docetaxel. Arch Biochem Biophys. 2019 Apr 15;665:69-78. doi: 10.1016/j.abb.2018.01.013. Epub 2018 Jan 31.
• Ref 3: MiR-183 modulates multi-drug resistance in hepatocellular cancer (HCC) cells via miR-183-IDH2/SOCS6-HIF-1Alpha feedback loop. Eur Rev Med Pharmacol Sci. 2016 May;20(10):2020-7.