Molecule Information

General Information of the Molecule (ID: Mol01386)
Name
hsa-mir-181c ,Homo sapiens
Synonyms
microRNA 181c
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR181C
Gene ID
406957
Location
chr19:13874699-13874808[+]
Sequence
CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCA
GGCAAACCAUCGACCGUUGAGUGGACCCUGAGGCCUGGAAUUGCCAUCCU
    Click to Show/Hide
Ensembl ID
ENSG00000207613
HGNC ID
HGNC:31552
Precursor Accession
MI0000271
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
H1299/DDP cells Lung Homo sapiens (Human) CVCL_0060
16HBE cells Lung Homo sapiens (Human) CVCL_0112
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis
Mechanism Description miR181c contributed to DDP resistance in NSCLC cells through activation of the Wnt/beta-catenin pathway by targeting WIF1. miR181c egatively regulates the expression of WIF1, anti-miR181c suppressed the Wnt/beta-catenin pathway by regulating WIF1.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell viability Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The microRNA miR-181c enhances chemosensitivity and reduces chemoresistance in breast cancer cells via down-regulating osteopontin.
Disease Class: Chronic myeloid leukemia [3]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
kCL22 cells Pleural effusion Homo sapiens (Human) CVCL_2091
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-181c directly targeted and inhibited the ST8SIA4 expression, as well as miR-181c was inversely correlated with the levels of ST8SIA4 expression in CML cell lines and samples. Moreover, ST8SIA4 could reverse the effect of miR-181c on drug resistance in k562 and k562/ADR cells in vitro. Upregulation of miR-181c sensitized k562/ADR cells to adriamycin in vivo through directly suppressing ST8SIA4 expression. Further investigation showed that miR-181c mediated the activity of phosphoinositide-3 kinase (PI3k)/AkT signal pathway, and inhibition of PI3k/Akt in k562 cells counteracted miR-181c-mediated MDR phenotype.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [4]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Hippo signaling pathway Regulation hsa04392
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [4]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Hippo signaling pathway Regulation hsa04392
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [5]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Response evaluation criteria in solid tumors assay
Mechanism Description Significant down-regulation of miR-181c in imatinib-resistant versus imatinib-responders was confirmed by qRT-PCR. Some miR-181c target genes such as PBX3, HSP90B1, NMT2 and RAD21 have been associated with drug response.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [4]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Hippo signaling pathway Regulation hsa04392
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [6]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma.
References
Ref 1 miR-181c contributes to cisplatin resistance in non-small cell lung cancer cells by targeting Wnt inhibition factor 1. Cancer Chemother Pharmacol. 2017 Nov;80(5):973-984. doi: 10.1007/s00280-017-3435-1. Epub 2017 Sep 27.
Ref 2 The microRNA miR-181c enhances chemosensitivity and reduces chemoresistance in breast cancer cells via down-regulating osteopontin. Int J Biol Macromol. 2019 Mar 15;125:544-556. doi: 10.1016/j.ijbiomac.2018.12.075. Epub 2018 Dec 8.
Ref 3 Upregulation of miR-181c inhibits chemoresistance by targeting ST8SIA4 in chronic myelocytic leukemia. Oncotarget. 2016 Sep 13;7(37):60074-60086. doi: 10.18632/oncotarget.11054.
Ref 4 Upregulation of miR-181c contributes to chemoresistance in pancreatic cancer by inactivating the Hippo signaling pathway. Oncotarget. 2015 Dec 29;6(42):44466-79. doi: 10.18632/oncotarget.6298.
Ref 5 Down-regulation of miR-181c in imatinib-resistant chronic myeloid leukemia. Mol Cytogenet. 2013 Jul 16;6(1):27. doi: 10.1186/1755-8166-6-27.
Ref 6 miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014 Apr;31(4):892. doi: 10.1007/s12032-014-0892-9. Epub 2014 Feb 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.