Molecule Information

General Information of the Molecule (ID: Mol01379)

• Name: hsa-mir-10a ,Homo sapiens
• Synonyms: microRNA 10a
• Molecule Type: Precursor miRNA
• Gene Name: MIR10A
• Gene ID: 406902
• Location: chr17:48579838-48579947[-]
• Sequence:
  GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUAAGGAAUUUUGUGGU
  CACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCCGCUCU
• Ensembl ID: ENSG00000284038
• HGNC ID: HGNC:31497
• Precursor Accession: MI0000266

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TGF-beta/Smad2/STAT3/STAT5 signaling pathway; Activation; hsa04350
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: miR-10a had an important role in promoting drug resistance in tumors through enhancing drug efflux and inhibiting apoptosis via upregulation of MDR1, MRP1 and RhoE expression. In addition, miR-10a promoted the expression of TGF-beta as wells as regulated the activity of the Smad2/STAT3/STAT5 pathway and its downstream transcriptional factors of HIF and eIF4E, which may be the potential mechanism of drug resistance in A549 cells. Therefore, miR-10a may be an important drug target for improving cancer treatment; however, further studies are required to explore the clinical applications of miR-10a inhibitors.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [2]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [3]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Upregulation of TUSC7,which acted by directly targeting and silencing expression of miR-10a gene, suppressed both TMZ resistance and expression of multidrug resistance protein 1 (MDR1) in U87TR cells,, and miR-10a mediated TUSC7-induced inhibition on TMZ resistance in U87TR cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [4]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-beta signaling pathway; Regulation; hsa04350
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: LncRNA RP11-838N2.4 (+) TMZ sensitivity in GBM by serving as a ceRNA, sequestering with miR-10a on an epigenetic level.

References

• Ref 1: MicroRNA-10a silencing reverses cisplatin resistance in the A549/cisplatin human lung cancer cell line via the transforming growth factor-Beta/Smad2/STAT3/STAT5 pathway. Mol Med Rep. 2015 May;11(5):3854-9. doi: 10.3892/mmr.2015.3181. Epub 2015 Jan 12.
• Ref 2: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 3: Long non-coding RNA TUSC7 inhibits temozolomide resistance by targeting miR-10a in glioblastoma. Cancer Chemother Pharmacol. 2018 Apr;81(4):671-678. doi: 10.1007/s00280-018-3522-y. Epub 2018 Feb 3.
• Ref 4: Long noncoding RNA RP11-838N2.4 enhances the cytotoxic effects of temozolomide by inhibiting the functions of miR-10a in glioblastoma cell lines. Oncotarget. 2016 Jul 12;7(28):43835-43851. doi: 10.18632/oncotarget.9699.