Molecule Information

General Information of the Molecule (ID: Mol01378)
Name
hsa-mir-7 ,Homo sapiens
Synonyms
microRNA 7-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR7-1
Gene ID
407043
Location
chr9:83969748-83969857[-]
Sequence
UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAA
AUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG
    Click to Show/Hide
Ensembl ID
ENSG00000284179
HGNC ID
HGNC:31638
Precursor Accession
MI0000263
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Cetuximab
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description microRNA-7 expression in colorectal cancer is associated with poor prognosis and regulates cetuximab sensitivity via EGFR regulation.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [2]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis
Mechanism Description Upregulation of miR7 increases the sensitivity of LA cells to CDDP via induction of apoptosis by targeting Bcl-2.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [4]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
RGFR signaling pathway Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description EGFR was negatively regulated by miR-7 mimic transfection, and downregulation of EGFR expression at the protein level largely correlated with elevated levels of miR-7 in the gefitinib-resistant cells. The results of the present study suggest that miR-7 may have central roles in the development of resistance to endocrine therapy in resistant cells through regulating the expression of EGFR in cancer cells.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [5]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [6]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation BCR-ABL/PI3K/AKT signaling pathway Inhibition hsa05220
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometric analysis
Mechanism Description miR7 inhibits cell proliferation and increases cell apoptosis in k562 cells and downregulates BCR-ABL/PI3k/AkT signaling in k562 cells, thus sensitizing k562 cells to imatinib.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
In Vivo Model Mouse xenograft models Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA.
Disease Class: Non-small cell lung cancer [7]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
95D cells Lung Homo sapiens (Human) CVCL_7110
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Overexpression of miR-7 sensitizes NSCLC cells to PTX and inhibites EGFR expression in A549 cells.
Trastuzumab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Trastuzumab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Colcount colony counter assay
Mechanism Description miR-7 suppression of HER2deta16 oncogenic activity is mediated through inactivation of Src kinase and suppression of EGFR expression implies that targeting these pathways would also suppress HER2deta16 tumorigenesis. HER2deta16 suppresses expression of the miR-7 tumor suppressor and reestablished miR-7 expression significantly inhibits HER2deta16 mediated tumor cell proliferation and migration and miR-7 sensitizes HER2deta16 expressing cells to trastuzumab treatment.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [9]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Sensitive Drug Vemurafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
MAPK/PI3K/AKT signaling pathway Inhibition hsa05235
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
Mel-CV cells Skin Homo sapiens (Human) CVCL_S996
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-7 expression was decreased in both VemR A375 and Mel-CVR melanoma cells and its low expression contributed to BRAFi resistance. Furthermore, by decreasing the expression levels of EGFR, IGF-1R and CRAF, miR-7 could inhibit the activation of RAS/RAF/MEk/ERk (MAPk) and PI3k/AkT pathway and partially reverse the resistance to BRAFi in VemR A375 melanoma cells.
References
Ref 1 MicroRNA-7 expression in colorectal cancer is associated with poor prognosis and regulates cetuximab sensitivity via EGFR regulation. Carcinogenesis. 2015 Mar;36(3):338-45. doi: 10.1093/carcin/bgu242. Epub 2014 Dec 10.
Ref 2 Prognostic Significance of microRNA-7 and its Roles in the Regulation of Cisplatin Resistance in Lung Adenocarcinoma. Cell Physiol Biochem. 2017;42(2):660-672. doi: 10.1159/000477884. Epub 2017 Jun 15.
Ref 3 PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. Mol Cancer. 2019 Jan 12;18(1):9. doi: 10.1186/s12943-019-0940-3.
Ref 4 MicroRNA expression profiles associated with acquired gefitinib-resistance in human lung adenocarcinoma cells. Mol Med Rep. 2015 Jan;11(1):333-40. doi: 10.3892/mmr.2014.2757. Epub 2014 Oct 23.
Ref 5 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 6 MicroRNA-7 inhibits cell proliferation of chronic myeloid leukemia and sensitizes it to imatinib in vitro. Biochem Biophys Res Commun. 2017 Dec 9;494(1-2):372-378. doi: 10.1016/j.bbrc.2017.10.001. Epub 2017 Oct 3.
Ref 7 MicroRNA-7 sensitizes non-small cell lung cancer cells to paclitaxel. Oncol Lett. 2014 Nov;8(5):2193-2200. doi: 10.3892/ol.2014.2500. Epub 2014 Sep 4.
Ref 8 MicroRNA-7 inhibits multiple oncogenic pathways to suppress HER2 Delta 16 mediated breast tumorigenesis and reverse trastuzumab resistance. PLoS One. 2014 Dec 22;9(12):e114419. doi: 10.1371/journal.pone.0114419. eCollection 2014.
Ref 9 miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570. doi: 10.18632/oncotarget.10669.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.