Molecule Information

General Information of the Molecule (ID: Mol01377)

• Name: hsa-mir-147 ,Homo sapiens
• Synonyms: microRNA 147a
• Molecule Type: Precursor miRNA
• Gene Name: MIR147A
• Gene ID: 406939
• Location: chr9:120244979-120245050[-]
• Sequence:
  AAUCUAAAGACAACAUUUCUGCACACACACCAGACUAUGGAAGCCAGUGUGUGGAAAUGC
  UUCUGCUAGAUU
• Ensembl ID: ENSG00000207814
• HGNC ID: HGNC:31534
• Precursor Accession: MI0000262

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR147 suppressed the proliferation and enhanced the chemosensitivity of gastric cancer cells to 5-FU by promoting cell apoptosis through directly targeting PTEN and regulating the PI3k/AkT signaling pathway. knockdown of pten reverses the effects of miR147 downregulation on gastric cancer cells.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance.

Disease Class: Lung cancer [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance.

References

• Ref 1: Downregulation of MicroRNA-147 Inhibits Cell Proliferation and Increases the Chemosensitivity of Gastric Cancer Cells to 5-Fluorouracil by Directly Targeting PTEN. Oncol Res. 2018 Jul 5;26(6):901-911. doi: 10.3727/096504017X15061902533715. Epub 2017 Sep 26.
• Ref 2: MicroRNA-147 induces a mesenchymal-to-epithelial transition (MET) and reverses EGFR inhibitor resistance. PLoS One. 2014 Jan 15;9(1):e84597. doi: 10.1371/journal.pone.0084597. eCollection 2014.