Molecule Information

General Information of the Molecule (ID: Mol01376)

• Name: hsa-mir-139 ,Homo sapiens
• Synonyms: microRNA 139
• Molecule Type: Precursor miRNA
• Gene Name: MIR139
• Gene ID: 406931
• Location: chr11:72615063-72615130[-]
• Sequence:
  GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUU
  GGAGUAAC
• Ensembl ID: ENSG00000272036
• HGNC ID: HGNC:31526
• Precursor Accession: MI0000261

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: SNU119 cells; Ovary; Homo sapiens (Human); CVCL_5014
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression of ATP7A/B was up-regulated in cisplatin-resistant ovarian cancer cell lines; miR-139 inversely regulates ATP7A/B expression through direct targeting, and affects ovarian cancer chemoresistance through regulation of ATP7A/B.

References

• Ref 1: MircroRNA-139 sensitizes ovarian cancer cell to cisplatin-based chemotherapy through regulation of ATP7A/B. Cancer Chemother Pharmacol. 2018 May;81(5):935-947. doi: 10.1007/s00280-018-3548-1. Epub 2018 Mar 28.