Molecule Information

General Information of the Molecule (ID: Mol01374)

• Name: hsa-mir-30c ,Homo sapiens
• Synonyms: microRNA 30c-2
• Molecule Type: Precursor miRNA
• Gene Name: MIR30C2
• Gene ID: 407032
• Location: chr6:71376960-71377031[-]
• Sequence:
  AGAUACUGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGAAAGCUGGGAGAAGGCUG
  UUUACUCUUUCU
• Ensembl ID: ENSG00000199094
• HGNC ID: HGNC:31627
• Precursor Accession: MI0000254

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p38/MAPK signaling pathway; Inhibition; hsa04010
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Down-regulation of miR-30c correlated with overexpression of YWHAZ in breast doxorubicin-resistant cells, Overexpression of miR-30c sensitized MCF-7/ADR cells to doxorubicin, miR-30c suppressed expression of the YWHAZ gene, YWHAZ was a key signal molecule in doxorubicin resistance by reducing activation of the p38MAPk signal pathway in MCF-7/ADR cells, miR-30c regulated doxorubicin resistance in vivo.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: G418 cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: NOD/SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-30c plays a pivotal role in Paclitaxel and Doxorubicin chemo-resistance by a direct targeting of TWF1, which encodes an actin-binding protein and promotes EMT.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: G418 cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: NOD/SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-30c plays a pivotal role in Paclitaxel and Doxorubicin chemo-resistance by a direct targeting of TWF1, which encodes an actin-binding protein and promotes EMT.

References

• Ref 1: Involvement of miR-30c in resistance to doxorubicin by regulating YWHAZ in breast cancer cells. Braz J Med Biol Res. 2014 Jan;47(1):60-9. doi: 10.1590/1414-431X20133324. Epub 2014 Jan 10.
• Ref 2: MicroRNA-30c inhibits human breast tumour chemotherapy resistance by regulating TWF1 and IL-11. Nat Commun. 2013;4:1393. doi: 10.1038/ncomms2393.