Molecule Information

General Information of the Molecule (ID: Mol01373)

• Name: hsa-mir-148a ,Homo sapiens
• Synonyms: microRNA 148a
• Molecule Type: Precursor miRNA
• Gene Name: MIR148A
• Gene ID: 406940
• Location: chr7:25949919-25949986[-]
• Sequence:
  GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAAC
  UUUGUCUC
• Ensembl ID: ENSG00000199085
• HGNC ID: HGNC:31535
• Precursor Accession: MI0000253

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Kidney cancer [1]

• Sensitive Disease: Kidney cancer [ICD-11: 2C90.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Caspase signaling pathway; Activation; hsa04210
• In Vitro Model: Caki cells; Kidney; Homo sapiens (Human); CVCL_0234
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay; PI/Annexin staining assay
• Mechanism Description: miR148a increases the sensitivity to cisplatin by targeting Rab14 in renal cancer cells, transfection with the miR148a mimics resulted in the activation of caspase pathway.

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Beta-catenin signaling pathway; Inhibition; hsa04520
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-148a suppressed expression of stem cell markers, inhibited sphere formation, invasion and migration, induced apoptosis, and reduced chemo-resistance in cisplatin-resistant SW480 cells while suppressing WNT10b expression and beta-catenin signaling activities.

Disease Class: Esophageal adenocarcinoma [3]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.

Disease Class: Esophageal squamous cell carcinoma [3]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal adenocarcinoma [3]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.

Disease Class: Esophageal squamous cell carcinoma [3]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [4]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MSK1 signaling pathway; Inhibition; hsa04010
• In Vitro Model: PC3PR cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell Growth Assay
• Mechanism Description: MSk1 is a novel target gene of miR-148a in both PC3 and PC3PR cells and miR-148 attenuates paclitaxel-resistance of PC3PR cells by modulating MSk1 expression.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-FITC Apoptosis Detection assay; Flow cytometry assay
• Mechanism Description: miR148a and miR152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM.

References

• Ref 1: miR-148a increases the sensitivity to cisplatin by targeting Rab14 in renal cancer cells. Int J Oncol. 2017 Mar;50(3):984-992. doi: 10.3892/ijo.2017.3851. Epub 2017 Jan 17.
• Ref 2: MiR-148a suppressed cell invasion and migration via targeting WNT10b and modulating Beta-catenin signaling in cisplatin-resistant colorectal cancer cells. Biomed Pharmacother. 2019 Jan;109:902-909. doi: 10.1016/j.biopha.2018.10.080. Epub 2018 Nov 5.
• Ref 3: Mir-148a improves response to chemotherapy in sensitive and resistant oesophageal adenocarcinoma and squamous cell carcinoma cells. J Gastrointest Surg. 2011 Mar;15(3):429-38. doi: 10.1007/s11605-011-1418-9. Epub 2011 Jan 19.
• Ref 4: MiR-148a attenuates paclitaxel resistance of hormone-refractory, drug-resistant prostate cancer PC3 cells by regulating MSK1 expression. J Biol Chem. 2010 Jun 18;285(25):19076-84. doi: 10.1074/jbc.M109.079525. Epub 2010 Apr 20.
• Ref 5: MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846. doi: 10.1016/j.bbrc.2017.01.012. Epub 2017 Jan 4.