Molecule Information

General Information of the Molecule (ID: Mol01372)

• Name: hsa-mir-129 ,Homo sapiens
• Synonyms: microRNA 129-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR129-1
• Gene ID: 406917
• Location: chr7:128207872-128207943[+]
• Sequence:
  GGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUAGUCAGGAAGCCCUUACCC
  CAAAAAGUAUCU
• Ensembl ID: ENSG00000207705
• HGNC ID: HGNC:31512
• Precursor Accession: MI0000252

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Intrinsic apoptotic signaling pathway; Activation; hsa04210
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR129 reversed cisplatin-resistance through inhibiting the P-gp expression in GC cells. miR129 activated the intrinsic apoptotic pathway via upregulating caspase-9 and caspase-3.

Cyclophosphamide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [2]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.11]
• Sensitive Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle; Inhibition; hsa04110
• In Vitro Model: IMR-32 cells; Abdomen; Homo sapiens (Human); CVCL_0346
• In Vitro Model: BE-M17 cells; Adrenal; Homo sapiens (Human); N.A.
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• In Vitro Model: NB-1643 cells; Adrenal; Homo sapiens (Human); CVCL_5627
• In Vitro Model: NB1 cells; Adrenal; Homo sapiens (Human); CVCL_1440
• In Vitro Model: NBSD cells; Adrenal; Homo sapiens (Human); CVCL_LF68
• In Vitro Model: Neuro-2a cells; Adrenal; Homo sapiens (Human); CVCL_0470
• In Vitro Model: Sk-N-AS cells; Adrenal; Homo sapiens (Human); CVCL_1700
• In Vitro Model: Sk-N-SH cells; Adrenal; Homo sapiens (Human); CVCL_0531
• In Vitro Model: Sk-SY-5Y cells; Adrenal; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-129 suppressed cell growth and potentiated chemosensitivity by inhibiting MYO10.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: CRC nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST assay
• Mechanism Description: microRNA-129 (miR-129) trigger apoptosis by suppressing key anti-apoptotic protein, B-cell lymphoma 2 (BCL2), enhanced the cytotoxic effect of 5-fluorouracil both in vitro and in vivo.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Esophageal squamous cell carcinoma [4]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: miR129/BCL2 signaling pathway; Regulation; hsa05206
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: KYSE-450 cells; Esophagus; Homo sapiens (Human); CVCL_1353
• In Vitro Model: TE6 cells; Esophageal; Homo sapiens (Human); CVCL_1765
• In Vitro Model: TE8 cells; Esophageal; Homo sapiens (Human); CVCL_1766
• In Vitro Model: TTn cells; Esophageal; Homo sapiens (Human); CVCL_3175
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; TUNEL assay
• Mechanism Description: Exosome-mediated transfer of PART1 promoted gefitinib resistance by competitively binding to miR-129 to facilitate Bcl-2 expression in ESCC cells.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [5]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: UCA1/miR129/ABCB1 signaling pathway; Regulation; hsa05206
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: Hey A8 cells; Ovary; Homo sapiens (Human); CVCL_8878
• Experiment for Molecule Alteration: RT-qPCR; RIP assay; Luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: ABCB1 up-regulated by UCA1/miR-129 axis contributed to PTX resistance in PTX-resistant OC cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: UCA1/miR129/ABCB1 signaling pathway; Regulation; hsa05206
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: Hey A8 cells; Ovary; Homo sapiens (Human); CVCL_8878
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: ABCB1 up-regulated by UCA1/miR-129 axis contributed to PTX resistance in PTX-resistant OC cells.

References

• Ref 1: MiR-129 regulates cisplatin-resistance in human gastric cancer cells by targeting P-gp. Biomed Pharmacother. 2017 Feb;86:450-456. doi: 10.1016/j.biopha.2016.11.139. Epub 2016 Dec 23.
• Ref 2: miR-129 inhibits tumor growth and potentiates chemosensitivity of neuroblastoma by targeting MYO10. Biomed Pharmacother. 2018 Jul;103:1312-1318. doi: 10.1016/j.biopha.2018.04.153. Epub 2018 May 7.
• Ref 3: miR-129 promotes apoptosis and enhances chemosensitivity to 5-fluorouracil in colorectal cancer. Cell Death Dis. 2013 Jun 6;4(6):e659. doi: 10.1038/cddis.2013.193.
• Ref 4: Exosome-mediated transfer of lncRNA PART1 induces gefitinib resistance in esophageal squamous cell carcinoma via functioning as a competing endogenous RNA. J Exp Clin Cancer Res. 2018 Jul 27;37(1):171. doi: 10.1186/s13046-018-0845-9.
• Ref 5: UCA1 confers paclitaxel resistance to ovarian cancer through miR-129/ABCB1 axis. Biochem Biophys Res Commun. 2018 Jul 2;501(4):1034-1040. doi: 10.1016/j.bbrc.2018.05.104. Epub 2018 May 19.