Molecule Information

General Information of the Molecule (ID: Mol01359)

• Name: hsa-mir-98 ,Homo sapiens
• Synonyms: microRNA 98
• Molecule Type: Precursor miRNA
• Gene Name: MIR98
• Gene ID: 407054
• Location: chrX:53556223-53556341[-]
• Sequence:
  AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUA
  GGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA
• Ensembl ID: ENSG00000271886
• HGNC ID: HGNC:31649
• Precursor Accession: MI0000100

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [1]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Drp1 signaling pathway; Activation; hsa04668
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: SV-HUC-1 cells; Bladder; Homo sapiens (Human); CVCL_3798
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [1]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Drp1 signaling pathway; Activation; hsa04668
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: SV-HUC-1 cells; Bladder; Homo sapiens (Human); CVCL_3798
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [3]

• Sensitive Disease: Leukemia [ICD-11: 2B33.6]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562/A02 cells; Blood; Homo sapiens (Human); CVCL_0368
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The targeted upregulated expression of miR98 could decrease the proliferation of leukemia cells and improve the sensitivity to chemotherapeutics by inhibiting E2F1 expression.

References

• Ref 1: MicroRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells. Exp Cell Res. 2018 Dec 15;373(1-2):188-197. doi: 10.1016/j.yexcr.2018.10.013. Epub 2018 Oct 25.
• Ref 2: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 3: Targeted regulation of MiR-98 on E2F1 increases chemosensitivity of leukemia cells K562/A02. Onco Targets Ther. 2017 Jun 29;10:3233-3239. doi: 10.2147/OTT.S126819. eCollection 2017.