Molecule Information

General Information of the Molecule (ID: Mol01357)

• Name: hsa-mir-93 ,Homo sapiens
• Synonyms: microRNA 93
• Molecule Type: Precursor miRNA
• Gene Name: MIR93
• Gene ID: 407050
• Location: chr7:100093768-100093847[-]
• Sequence:
  CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACCCAACCUACUGCUGAGCU
  AGCACUUCCCGAGCCCCCGG
• Ensembl ID: ENSG00000207757
• HGNC ID: HGNC:31645
• Precursor Accession: MI0000095

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cabergoline

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Cabergoline
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: CCK-8 assay
• Mechanism Description: Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Activation; hsa05235
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-93, a new family member of PTEN regulator, blocks PTEN translation leading to activation of the AkT pathway and played an important role in regulating cisplatin chemosensitivity pathway in ovarian cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: There is an elevated expression of DNA polymerase Eta (Pol Eta) in ovarian CSCs isolated from both ovarian cancer cell lines and primary tumors, indicating that CSCs may have intrinsically (+) translesion DNA synthesis (TLS). Down-regulation of Pol Eta blocked cisplatin-induced CSC enrichment both in vitro and in vivo through the enhancement of cisplatin-induced apoptosis in CSCs, indicating that Pol Eta-mediated TLS contributes to the survival of CSCs upon cisplatin treatment. Furthermore, our data demonstrated a depletion of miR-93 in ovarian CSCs. Enforced expression of miR-93 in ovarian CSCs reduced Pol Eta expression and increased their sensitivity to cisplatin. Taken together, our data suggest that ovarian CSCs have intrinsically (+) Pol Eta-mediated TLS, allowing CSCs to survive cisplatin treatment, leading to tumor relapse. Targeting Pol Eta, probably through enhancement of miR-93 expression, might be exploited as a strategy to increase the efficacy of cisplatin treatment.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell motility; Activation; hsa04510
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Self-renewal signaling pathway; Activation; hsa04550
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR93 contributes to inducing EMT and drug resistance of breast cancer cells by targeting PTEN.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: Involvement of microRNA-93, a new regulator of PTEN/Akt signaling pathway, in regulation of chemotherapeutic drug cisplatin chemosensitivity in ovarian cancer cells. FEBS Lett. 2012 May 7;586(9):1279-86. doi: 10.1016/j.febslet.2012.03.006. Epub 2012 Mar 27.
• Ref 3: Enhanced expression of DNA polymerase eta contributes to cisplatin resistance of ovarian cancer stem cells. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4411-6. doi: 10.1073/pnas.1421365112. Epub 2015 Mar 23.
• Ref 4: miR-93 and PTEN: Key regulators of doxorubicin-resistance and EMT in breast cancer. Oncol Rep. 2017 Oct;38(4):2401-2407. doi: 10.3892/or.2017.5859. Epub 2017 Jul 31.