Molecule Information

General Information of the Molecule (ID: Mol01352)
Name
hsa-mir-30a ,Homo sapiens
Synonyms
microRNA 30a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR30A
Gene ID
407029
Location
chr6:71403551-71403621[-]
Sequence
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUG
UUUGCAGCUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207827
HGNC ID
HGNC:31624
Precursor Accession
MI0000088
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
 Disease Info 
Resistant Drug Bromocriptine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration		 Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance		 Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-sqPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The IC50 of CDDP in the SGC7901/CDDP-miR-30a mimics group was decreased to 8.56 M (P<0.001 vs. SGC7901/CDDP group), indicating increased chemosensitivity following miR-30a transfectionand the expression of P-gp protein was notably elevated in SGC7901/CDDP cells compared with SGC7901 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-qPCR; Western blot analysiss
Experiment for
Drug Resistance		 MTT assay
Mechanism Description EMT is associated with cisplatin resistance in gastric cancer. miR-30a is an important miRNA modulating EMT and cisplatin sensitivity of SGC-7901 and SGC-7901/DDP cells.
Disease Class: Ovarian cancer [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/MAPK signaling pathway Inhibition hsa04010
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model HEY cells Ovary Homo sapiens (Human) CVCL_0297
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Trypan blue dye exclusion method assay; Transwell assay
Mechanism Description Overexpression of miR-30a decreases cellular vitality, invasion, plasticity and EMT. ETAR is identified as a direct target of miR-30a, and their expression is inversely correlated in EOC cell lines and human tissue samples. Upregulation of miR-30a re-sensitizes resistant EOC cells to cisplatinum by binding ETAR. Overexpression of miR-30a inhibits tumor growth in cisplatinum-resistant xenografts.
Disease Class: Breast cancer [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Cervical cancer [5]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Hepatocellular carcinoma [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Hepatocellular carcinoma [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HepS cells Liver Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [7]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Down-regulation of miR-30a contributed to chemoresistance of osteosarcoma cells through regulating autophagy. Furthermore, to investigate the mechanism of miR-130a in regulating autophagy, bioinformatics analysis was performed. The results showed that the 3'-UTR region of Beclin-1 were the binding sites for miR-30a. Consistently, previous studies demonstrated that Beclin-1 was the directly target of miR-30a.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [8]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell proliferation Inhibition hsa05200
SNAI1/IRS1/AKT signaling pathway Regulation hsa04151
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-30a overexpression suppresses cell proliferation, and sensitizes pancreatic cancer cells to gemcitabine and miR-30a overexpression reduced IRS1 and SNAI1 protein level.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [9], [10]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Intrinsic apoptotic signaling pathway Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-30a mimic or knockdown of autophagy genes (ATGs) such as Beclin 1 and ATG5 by short hairpin RNA enhances imatinib-induced cytotoxicity and promotes mitochondria-dependent intrinsic apoptosis. In contrast, knockdown of miR-30a by antagomiR-30a increases the expression of Beclin 1 and ATG5, and inhibits imatinib-induced cytotoxicity. And MIR30A mimics, as well as knockdown of BECN1 and ATG5, increases intrinsic apoptotic pathways.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 miR-30 decreases multidrug resistance in human gastric cancer cells by modulating cell autophagy. Exp Ther Med. 2018 Jan;15(1):599-605. doi: 10.3892/etm.2017.5354. Epub 2017 Oct 23.
Ref 3 MiR-30a increases cisplatin sensitivity of gastric cancer cells through suppressing epithelial-to-mesenchymal transition (EMT). Eur Rev Med Pharmacol Sci. 2016 May;20(9):1733-9.
Ref 4 miR-30a inhibits endothelin A receptor and chemoresistance in ovarian carcinoma. Oncotarget. 2016 Jan 26;7(4):4009-23. doi: 10.18632/oncotarget.6546.
Ref 5 MicroRNA-30a sensitizes tumor cells to cis-platinum via suppressing beclin 1-mediated autophagy. J Biol Chem. 2012 Feb 3;287(6):4148-56. doi: 10.1074/jbc.M111.307405. Epub 2011 Dec 8.
Ref 6 MiR-30a Decreases Multidrug Resistance (MDR) of Gastric Cancer Cells. Med Sci Monit. 2016 Nov 23;0:0.
Ref 7 MicroRNA-30a downregulation contributes to chemoresistance of osteosarcoma cells through activating Beclin-1-mediated autophagy. Oncol Rep. 2016 Mar;35(3):1757-63. doi: 10.3892/or.2015.4497. Epub 2015 Dec 18.
Ref 8 MiR-30a regulates cancer cell response to chemotherapy through SNAI1/IRS1/AKT pathway. Cell Death Dis. 2019 Feb 15;10(3):153. doi: 10.1038/s41419-019-1326-6.
Ref 9 Targeting microRNA-30a-mediated autophagy enhances imatinib activity against human chronic myeloid leukemia cells. Leukemia. 2012 Aug;26(8):1752-60. doi: 10.1038/leu.2012.65. Epub 2012 Mar 7.
Ref 10 microRNA 30A promotes autophagy in response to cancer therapy. Autophagy. 2012 May 1;8(5):853-5. doi: 10.4161/auto.20053. Epub 2012 May 1.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.