Molecule Information

General Information of the Molecule (ID: Mol01350)

• Name: hsa-mir-27a ,Homo sapiens
• Synonyms: microRNA 27a
• Molecule Type: Precursor miRNA
• Gene Name: MIR27A
• Gene ID: 407018
• Location: chr19:13836440-13836517[-]
• Sequence:
  CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGG
  CUAAGUUCCGCCCCCCAG
• Ensembl ID: ENSG00000207808
• HGNC ID: HGNC:31613
• Precursor Accession: MI0000085

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-27a acts as an oncogene in ovarian cancer and regulates their proliferation, invasion and chemosensitivity by targeting CUL5.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Esophageal cancer [2]

• Resistant Disease: Esophageal cancer [ICD-11: 2B70.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: TE10 cells; Esophagus; Homo sapiens (Human); CVCL_1760
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-27 in serum originated mainly from esophageal cancer cells, because its serum expression level in patients with esophageal cancer was significantly higher than that of healthy volunteers and decreased significantly after surgery compared with the baseline (before surgery). Moreover, co-culture of fibroblasts with anti-miR-27-transfected esophageal cancer cells resulted in a major decrease in the antiapoptotic function of fibroblasts, compared with fibroblasts co-cultured with control esophageal cancer cells that secrete extracellular miR-27. Serum miR-27 level may reflect the expression level of extracellular miR-27 derived from esophageal cancer cells. miR-27 is involved in resistance to chemotherapy in esophageal cancer, through miR-27 -induced transformation of NOF into CAF, and that TGF-beta secreted from these CAF-like fibroblasts induces chemoresistance to cisplatin in esophageal cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [3]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: EJ/T24 cells; Bladder; Homo sapiens (Human); N.A.
• In Vitro Model: RT112 cells; Bladder; Homo sapiens (Human); CVCL_1670
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Clonogenic survival assay
• Mechanism Description: Cisplatin resistance is mediated through increased expression of SLC7A11 and increased production of glutathione, Overexpression of microRNA 27a reduces levels of SLC7A11 and intracellular glutathione, and resensitises resistant cells to cisplatin, SLC7A11 is a key modulator of cisplatin resistance in bladder cancer cells.

Disease Class: Esophageal squamous cell carcinoma [4]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a significantly decreased expression of MDR1, but did not alter the expression of MRP, miR-27a could possibly mediate drug resistance, at least in part through regulation of MDR1 and apoptosis.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-27a acts as an oncogene in ovarian cancer and regulates their proliferation, invasion and chemosensitivity by targeting CUL5.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [5]

• Resistant Disease: Leukemia [ICD-11: 2B33.6]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression of miR-331-5p and miR-27a was inversely correlated with MDR1 expression. Transfection of exogenous miR-27a or miR-331-5p, or a combination of these two miRNAs, down-regulated MDR1 and increased sensitivity of the k562-resistant cancer cells to DOX.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Tumorigenesis; Inhibition; hsa05200
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21.

Disease Class: Esophageal squamous cell carcinoma [4]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a significantly decreased expression of MDR1, but did not alter the expression of MRP, miR-27a could possibly mediate drug resistance, at least in part through regulation of MDR1 and apoptosis.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Tumorigenesis; Inhibition; hsa05200
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21.

Disease Class: Esophageal squamous cell carcinoma [4]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a significantly decreased expression of MDR1, but did not alter the expression of MRP, miR-27a could possibly mediate drug resistance, at least in part through regulation of MDR1 and apoptosis.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [7]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miRNAs/HIPk2/MDR1/P-gp signaling pathway; Regulation; hsa05206
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Transfection of A2780/Taxol cells with the inhibitors of miR-27a decreased the expression of MDR1 mRNA and P-gp protein, increased HIPk2 protein expression, enhanced the sensitivity of A2780/taxol cells to paclitaxel, increased paclitaxel-induced apoptosis and the fluorescence intensity of intracellular Rh-123. The deregulation of miR-27a may be involved in the development of drug resistance, regulating the expression of MDR1/P-gp, at least in part, by targeting HIPk2 in ovarian cancer cells.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: ATP-content assay
• Mechanism Description: miR-27a sensitizes luminal A breast cancer cells to SERM treatments based on a positive feedback loop with ERalpha.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Tumorigenesis; Inhibition; hsa05200
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21.

Disease Class: Esophageal squamous cell carcinoma [4]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Down-regulation of miR-27a significantly decreased expression of MDR1, but did not alter the expression of MRP, miR-27a could possibly mediate drug resistance, at least in part through regulation of MDR1 and apoptosis.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [9]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: FHC cells; Colon; Homo sapiens (Human); CVCL_3688
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Knockdown of miR27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex. miR27a antioligonucleotides enhanced the anti-tumor effect of TRAIL on colorectal cancer stem cells via increasing the expression of Apaf-1.

Disease Class: Acute myeloid leukemia [10]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562/A02 cells; Blood; Homo sapiens (Human); CVCL_0368
• In Vitro Model: NB4 cells; Bone marrow; Homo sapiens (Human); CVCL_0005
• In Vitro Model: HL-60/ADR cells; Blood; Homo sapiens (Human); CVCL_0304
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-424 and miR-27a increase TRAIL sensitivity of acute myeloid leukemia by targeting PLAG1.

References

• Ref 1: MicroRNA-27a regulates the proliferation, chemosensitivity and invasion of human ovarian cancer cell lines by targeting Cullin 5. Arch Biochem Biophys. 2019 Jun 15;668:9-15. doi: 10.1016/j.abb.2019.04.009. Epub 2019 Apr 29.
• Ref 2: miR-27 is associated with chemoresistance in esophageal cancer through transformation of normal fibroblasts to cancer-associated fibroblasts. Carcinogenesis. 2015 Aug;36(8):894-903. doi: 10.1093/carcin/bgv067. Epub 2015 May 30.
• Ref 3: Reduced expression of miRNA-27a modulates cisplatin resistance in bladder cancer by targeting the cystine/glutamate exchanger SLC7A11. Clin Cancer Res. 2014 Apr 1;20(7):1990-2000. doi: 10.1158/1078-0432.CCR-13-2805. Epub 2014 Feb 10.
• Ref 4: Down-regulation of miR-27a might reverse multidrug resistance of esophageal squamous cell carcinoma. Dig Dis Sci. 2010 Sep;55(9):2545-51. doi: 10.1007/s10620-009-1051-6. Epub 2009 Dec 4.
• Ref 5: Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia. J Cell Mol Med. 2011 Oct;15(10):2164-75. doi: 10.1111/j.1582-4934.2010.01213.x.
• Ref 6: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 7: MiR-27a modulates MDR1/P-glycoprotein expression by targeting HIPK2 in human ovarian cancer cells. Gynecol Oncol. 2010 Oct;119(1):125-30. doi: 10.1016/j.ygyno.2010.06.004. Epub 2010 Jul 10.
• Ref 8: MiRNA-27a sensitizes breast cancer cells to treatment with Selective Estrogen Receptor Modulators. Breast. 2019 Feb;43:31-38. doi: 10.1016/j.breast.2018.10.007. Epub 2018 Oct 18.
• Ref 9: Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex. Oncotarget. 2017 Jul 11;8(28):45213-45223. doi: 10.18632/oncotarget.16779.
• Ref 10: MiR-424 and miR-27a increase TRAIL sensitivity of acute myeloid leukemia by targeting PLAG1. Oncotarget. 2016 May 3;7(18):25276-90. doi: 10.18632/oncotarget.8252.