Molecule Information

General Information of the Molecule (ID: Mol01349)

• Name: hsa-mir-26b ,Homo sapiens
• Synonyms: microRNA 26b
• Molecule Type: Precursor miRNA
• Gene Name: MIR26B
• Gene ID: 407017
• Location: chr2:218402646-218402722[+]
• Sequence:
  CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUA
  CUUGGCUCGGGGACCGG
• Ensembl ID: ENSG00000199121
• HGNC ID: HGNC:31612
• Precursor Accession: MI0000084

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [1]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Overexpression of miR26b decreases the cisplatin-resistance in laryngeal cancer by targeting ATF2. miR26b in Hep-2/R decreased the expression of ATF2, and thus inhibiting the phosphorylation of ATF2 and formation of cellular ATF2-c-Jun complex induced by cisplatin. As the results, Hep-2/R cells failed to overexpress the Bcl-xl which is a key anti-apoptotic protein under the cisplatin treatment. Therefore, overexpression of miR26b was found to be able to promote mitochondrial apoptosis induced by cisplatin.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell autophagy; Inhibition; hsa04140
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR26a/b can promote apoptosis and sensitize HCC to chemotherapy via suppressing the expression of autophagy initiator ULk.

Disease Class: Hepatocellular carcinoma [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: QGY-7703 cells; Liver; Homo sapiens (Human); CVCL_6715
• In Vitro Model: MHCC97-H cells; Liver; Homo sapiens (Human); CVCL_4972
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-26b suppresses NF-kB signaling and thereby sensitized HCC cells to the doxorubicin-induced apoptosis by inhibiting the expression of TAk1 and TAB3.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MCF7/TAMR cells; Breast; Homo sapiens (Human); CVCL_EG55
• In Vitro Model: T47D/TAMR cells; Breast; Homo sapiens (Human); CVCL_1D36
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The ERBB2 expression is regulated at the post-transcriptional level by miR26a/b and the RNA-binding protein human antigen R, miR26a/b inhibits the translation of ERBB2 mRNA, whereas HuR enhances the stability of the ERBB2 mRNA.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Glioma [5]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: SNB19 TR cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: T98G TR cells; Brain; Homo sapiens (Human); CVCL_0556
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT Assay; Wound healing assay; Transwell invasion assays
• Mechanism Description: miR26b reverses temozolomide resistance via targeting Wee1 in glioma cells. miR26b governed TR-mediate EMT partly due to governing its target Wee1.

References

• Ref 1: Overexpression of miR-26b decreases the cisplatin-resistance in laryngeal cancer by targeting ATF2. Oncotarget. 2017 Sep 8;8(45):79023-79033. doi: 10.18632/oncotarget.20784. eCollection 2017 Oct 3.
• Ref 2: MiR-26 enhances chemosensitivity and promotes apoptosis of hepatocellular carcinoma cells through inhibiting autophagy. Cell Death Dis. 2017 Jan 12;8(1):e2540. doi: 10.1038/cddis.2016.461.
• Ref 3: MicroRNA-26b suppresses the NF-kB signaling and enhances the chemosensitivity of hepatocellular carcinoma cells by targeting TAK1 and TAB3. Mol Cancer. 2014 Feb 24;13:35. doi: 10.1186/1476-4598-13-35.
• Ref 4: Post-transcriptional regulation of ERBB2 by miR26a/b and HuR confers resistance to tamoxifen in estrogen receptor-positive breast cancer cells. J Biol Chem. 2017 Aug 18;292(33):13551-13564. doi: 10.1074/jbc.M117.780973. Epub 2017 Jun 21.
• Ref 5: MiR-26b reverses temozolomide resistance via targeting Wee1 in glioma cells. Cell Cycle. 2017 Oct 18;16(20):1954-1964. doi: 10.1080/15384101.2017.1367071. Epub 2017 Sep 12.