Molecule Information

General Information of the Molecule (ID: Mol01348)

• Name: hsa-mir-26a ,Homo sapiens
• Synonyms: microRNA 26a-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR26A1
• Gene ID: 407015
• Location: chr3:37969404-37969480[+]
• Sequence:
  GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGU
  UACUUGCACGGGGACGC
• Ensembl ID: ENSG00000199075
• HGNC ID: HGNC:31610
• Precursor Accession: MI0000083

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Inhibition; hsa04140
• Cell Pathway Regulation: miR26a/GSk3Beta/Mcl1 signaling pathway; Regulation; hsa05206
• In Vitro Model: U251-MG cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC staining assay; Flow cytometry assay
• Mechanism Description: Long non-coding RNA AC023115.3 suppresses chemoresistance of glioblastoma by reducing autophagy. AC023115.3 acts as a competing endogenous RNA for miR26a and attenuates the inhibitory effect of miR26a on GSk3beta, leading to an increase in GSk3beta and a decrease in autophagy.

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HMGA2-E2F1-AKT signaling pathway; Inhibition; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Decreased MicroRNA-26a expression significantly decreased the expression of E2F1, diminished Akt phosphorylation, and downregulated Bcl2 expression, which causes cisplatin resistance in human non-small cell lung cancer.

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: NRAS and E2F2 as the direct targets of miR-26a were further confirmed in luciferase activity assays and miR-26a-mediated these two genes expression analysis. Our results also found that knockdown of NRAS or E2F2 sensitize GC cells to cisplatin. miR-26a overexpression has been demonstrated to improve the sensitivity of GC cells to cisplatin and this effect was considered to be mediated via its targets NRAS and E2F2.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR26a/b can promote apoptosis and sensitize HCC to chemotherapy via suppressing the expression of autophagy initiator ULk.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: EGFR signaling pathway; Activation; hsa01521
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: NCI-H520 cells; Lung; Homo sapiens (Human); CVCL_1566
• In Vitro Model: H2170 cells; Lung; Homo sapiens (Human); CVCL_1535
• In Vitro Model: SW900 cells; Lung; Homo sapiens (Human); CVCL_1731
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-26a desensitizes non-small cell lung cancer cells to tyrosine kinase inhibitors by targeting and reducing the level of PTPN1.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• In Vitro Model: 184A1 cells; Breast; Homo sapiens (Human); CVCL_3040
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MCL-1(myeloid cell leukemia 1), a pro-survival member of the Bcl-2(B-cell CLL/lymphoma 2) family, several miRNAs induces apoptosis by targeting MCL-1, miR-26a Inhibits MCL-1 expression, increased sensitivity of breast cancer cells to paclitaxel.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Both miR-26a knockdown and E2F7 overexpression conferred resistance to TAM in MCF-7 cells and there is an inverse correlation between miR-26a and E2F7 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MCF7/TAMR cells; Breast; Homo sapiens (Human); CVCL_EG55
• In Vitro Model: T47D/TAMR cells; Breast; Homo sapiens (Human); CVCL_1D36
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The ERBB2 expression is regulated at the post-transcriptional level by miR26a/b and the RNA-binding protein human antigen R, miR26a/b inhibits the translation of ERBB2 mRNA, whereas HuR enhances the stability of the ERBB2 mRNA.

References

• Ref 1: Long non-coding RNA AC023115.3 suppresses chemoresistance of glioblastoma by reducing autophagy. Biochim Biophys Acta Mol Cell Res. 2017 Aug;1864(8):1393-1404. doi: 10.1016/j.bbamcr.2017.05.008. Epub 2017 May 9.
• Ref 2: Decreased MicroRNA-26a expression causes cisplatin resistance in human non-small cell lung cancer. Cancer Biol Ther. 2016 May 3;17(5):515-25. doi: 10.1080/15384047.2015.1095405. Epub 2015 Oct 22.
• Ref 3: MiR-26a enhances the sensitivity of gastric cancer cells to cisplatin by targeting NRAS and E2F2. Saudi J Gastroenterol. 2015 Sep-Oct;21(5):313-9. doi: 10.4103/1319-3767.166206.
• Ref 4: MiR-26 enhances chemosensitivity and promotes apoptosis of hepatocellular carcinoma cells through inhibiting autophagy. Cell Death Dis. 2017 Jan 12;8(1):e2540. doi: 10.1038/cddis.2016.461.
• Ref 5: miR-26a desensitizes non-small cell lung cancer cells to tyrosine kinase inhibitors by targeting PTPN13. Oncotarget. 2016 Jul 19;7(29):45687-45701. doi: 10.18632/oncotarget.9920.
• Ref 6: MiR-26a inhibits proliferation and migration of breast cancer through repression of MCL-1. PLoS One. 2013 Jun 4;8(6):e65138. doi: 10.1371/journal.pone.0065138. Print 2013.
• Ref 7: A miR-26a/E2F7 feedback loop contributes to tamoxifen resistance in ER-positive breast cancer. Int J Oncol. 2018 Oct;53(4):1601-1612. doi: 10.3892/ijo.2018.4492. Epub 2018 Jul 19.
• Ref 8: Post-transcriptional regulation of ERBB2 by miR26a/b and HuR confers resistance to tamoxifen in estrogen receptor-positive breast cancer cells. J Biol Chem. 2017 Aug 18;292(33):13551-13564. doi: 10.1074/jbc.M117.780973. Epub 2017 Jun 21.