Molecule Information

General Information of the Molecule (ID: Mol01346)

• Name: hsa-mir-24 ,Homo sapiens
• Synonyms: microRNA 24-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR24-1
• Gene ID: 407012
• Location: chr9:95086021-95086088[+]
• Sequence:
  CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGG
  AACAGGAG
• Ensembl ID: ENSG00000284459
• HGNC ID: HGNC:31607
• Precursor Accession: MI0000080

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: FIH1/HIFalpha signaling pathway; Regulation; hsa04066
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Caspase-Glo 3/7 Assay; Transwell migration assay
• Mechanism Description: miR24 increases under hypoxic conditions, causing downregulation of FIH1 and upregulation of HIF1alpha. miR24 hampers chemotherapy-induced apoptosis in breast CSCs and increases cell resistance to hypoxic conditions through an FIH1 HIFalpha pathway.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast carcinoma [2]

• Sensitive Disease: Breast carcinoma [ICD-11: 2C60.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; TUNEL assay
• Mechanism Description: Overexpression of microRNA-24 increases the sensitivity to paclitaxel in drug-resistant breast carcinoma cell lines via targeting ABCB9.

Disease Class: Endometrial carcinoma [3]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vivo Model: Crl:NU-Foxn1nu nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-24, which is under-expressed in EC, functions as a tumor-suppressing gene to inhibit malignant proliferation and advance chemotherapy sensitivity to paclitaxel in EC by targeted silencing of S100A8.

References

• Ref 1: MiR-24 induces chemotherapy resistance and hypoxic advantage in breast cancer. Oncotarget. 2017 Mar 21;8(12):19507-19521. doi: 10.18632/oncotarget.14470.
• Ref 2: Overexpression of microRNA-24 increases the sensitivity to paclitaxel in drug-resistant breast carcinoma cell lines via targeting ABCB9. Oncol Lett. 2016 Nov;12(5):3905-3911. doi: 10.3892/ol.2016.5139. Epub 2016 Sep 15.
• Ref 3: Targeted Silencing of S100A8 Gene by miR-24 to Increase Chemotherapy Sensitivity of Endometrial Carcinoma Cells to Paclitaxel. Med Sci Monit. 2016 Jun 9;22:1953-8. doi: 10.12659/msm.899179.