Molecule Information

General Information of the Molecule (ID: Mol01342)
Name
hsa-mir-20a ,Homo sapiens
Synonyms
microRNA 20a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR20A
Gene ID
406982
Location
chr13:91351065-91351135[+]
Sequence
GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACU
UAAAGUACUGC
    Click to Show/Hide
Ensembl ID
ENSG00000283762
HGNC ID
HGNC:31577
Precursor Accession
MI0000076
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
NF-kappaB signaling pathway Activation hsa04064
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Flow cytometry assay; MTT assay
Mechanism Description miR-20a directly targeted CYLD, resulting in activation of the NFkB pathway and the downstream targets, livin and survivin, which potentially contributed to GC chemoresistance.
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
EGR2 signaling pathway Inhibition hsa04625
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
NUGC3 cells Gastric Homo sapiens (Human) CVCL_1612
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-20a promoted the growth, migration and invasion of GC cells, enhanced the chemoresistance of GC cells to cisplatin and docetaxel. Luciferase activity and Western blot confirmed that miR-20a negatively regulated EGR2 expression. Overexpression of EGR2 significantly attenuated the oncogenic effect of miR-20a.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Activation hsa04670
TGF-beta signaling pathway Activation hsa04350
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8-8 assay; Transwell migration assay; Promega assay
Mechanism Description miR-17, 20a, 20b were down-regulation in cisplatin-resistant A549/DDP cells compared with A549 cells. inhibition of miR-17, 20a, 20b increased cisplatin-resistant and migration of A549 cells, and over-expression of miR-17, 20a, 20b decreased cisplatin-resistant and migration of A549/DDP cells. miR-17, 20a, 20b blunted the TGFbeta signal pathway by directly inhibiting its important component TGFbetaR2. TGFbetaR2 silenced led to cisplatin sensitivity and migration inhibition in A549/DDP cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [4]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
ROS/ASk1/JNk signaling pathway Activation hsa04071
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Knockdown of miR-20a enhanced sensitivity of colorectal cancer cells to cisplatin through the ROS/ASk1/JNk pathway.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
EGR2 signaling pathway Inhibition hsa04625
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
NUGC3 cells Gastric Homo sapiens (Human) CVCL_1612
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-20a promoted the growth, migration and invasion of GC cells, enhanced the chemoresistance of GC cells to cisplatin and docetaxel. Luciferase activity and Western blot confirmed that miR-20a negatively regulated EGR2 expression. Overexpression of EGR2 significantly attenuated the oncogenic effect of miR-20a.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [5]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
MAPK/ERK signaling pathway Inhibition hsa04010
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The restoration of miR-20a expression significantly reduced LRIG1-induced GC cell chemosensitivity.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal adenocarcinoma [6]
Sensitive Disease Colorectal adenocarcinoma [ICD-11: 2B91.2]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal adenocarcinoma [6]
Sensitive Disease Colorectal adenocarcinoma [ICD-11: 2B91.2]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.
Teniposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal adenocarcinoma [6]
Sensitive Disease Colorectal adenocarcinoma [ICD-11: 2B91.2]
 Disease Info 
Sensitive Drug Teniposide
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [5]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
MAPK/ERK signaling pathway Inhibition hsa04010
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The restoration of miR-20a expression significantly reduced LRIG1-induced GC cell chemosensitivity.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [7]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug TRAIL
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation TBID/Mitochondria signaling pathway Activation hsa04217
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
NCI-H508 cells Colon Homo sapiens (Human) CVCL_1564
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
SW948 cells Colon Homo sapiens (Human) CVCL_0632
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; FITC-Annexin V and propidium iodide (PI) assay
Mechanism Description The knockdown of miR20a inhibited the translocation of tBID to the mitochondria, which induced the mitochondrial pathway of apoptosis, the knockdown of miR20a also reversed the resistance of TRAIL in established TRAIL-resistant SW480 cells by tBID-mitochondria pathway.
References
Ref 1 miR-20a induces cisplatin resistance of a human gastric cancer cell line via targeting CYLD. Mol Med Rep. 2016 Aug;14(2):1742-50. doi: 10.3892/mmr.2016.5413. Epub 2016 Jun 21.
Ref 2 Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2). Int J Mol Sci. 2013 Aug 6;14(8):16226-39. doi: 10.3390/ijms140816226.
Ref 3 MiRNA 17 family regulates cisplatin-resistant and metastasis by targeting TGFbetaR2 in NSCLC. PLoS One. 2014 Apr 10;9(4):e94639. doi: 10.1371/journal.pone.0094639. eCollection 2014.
Ref 4 Knockdown of MiR-20a Enhances Sensitivity of Colorectal Cancer Cells to Cisplatin by Increasing ASK1 Expression. Cell Physiol Biochem. 2018;47(4):1432-1441. doi: 10.1159/000490834. Epub 2018 Jun 19.
Ref 5 Downregulation of leucine-rich repeats and immunoglobulin-like domains 1 by microRNA-20a modulates gastric cancer multidrug resistance. Cancer Sci. 2018 Apr;109(4):1044-1054. doi: 10.1111/cas.13538. Epub 2018 Mar 23.
Ref 6 miR-20a targets BNIP2 and contributes chemotherapeutic resistance in colorectal adenocarcinoma SW480 and SW620 cell lines. Acta Biochim Biophys Sin (Shanghai). 2011 Mar;43(3):217-25. doi: 10.1093/abbs/gmq125. Epub 2011 Jan 17.
Ref 7 miR-20a-directed regulation of BID is associated with the TRAIL sensitivity in colorectal cancer. Oncol Rep. 2017 Jan;37(1):571-578. doi: 10.3892/or.2016.5278. Epub 2016 Nov 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.