Molecule Information

General Information of the Molecule (ID: Mol01339)

• Name: hsa-mir-18a ,Homo sapiens
• Synonyms: microRNA 18a
• Molecule Type: Precursor miRNA
• Gene Name: MIR18A
• Gene ID: 406953
• Location: chr13:91350751-91350821[+]
• Sequence:
  UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC
  UCCUUCUGGCA
• Ensembl ID: ENSG00000283815
• HGNC ID: HGNC:31548
• Precursor Accession: MI0000072

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR18a/PTEN signaling pathway; Regulation; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: TP53TG1 increased the sensitivity of NSCLC cells to cisplatin by modulating miR-18a/PTEN axis by promoting PTEN expression via inhibiting miR-18a.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-18a is an important miRNA that suppresses Dicer expression and increases paclitaxel resistance in triple-negative breast cancer cells.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: qRT-PCR; Dual luciferase assay
• Experiment for Drug Resistance: CCK8 assay; Soft agar assay; Flow cytometric analysis
• Mechanism Description: Long non-coding RNA UCA1 enhances tamoxifen resistance in breast cancer cells through a miR18a-HIF1alpha feedback regulatory loop. The upregulated UCA1 sponges miR18a, which is a negative regulator of HIF1alpha.

Trastuzumab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Matrigel Invasion assay
• Mechanism Description: UCA1 knockdown upregulated miR-18a and downregulated YAP1 in breast cancer cells, restoring sensitivity of breast cancer cells to trastuzumab.

Clinical Trial Drug(s) 1 drug(s) in total

Oncolytic vaccinia virus

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [5]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oncolytic vaccinia virus
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Virus binding and entry assays
• Mechanism Description: Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer.

References

• Ref 1: TP53TG1 enhances cisplatin sensitivity of non-small cell lung cancer cells through regulating miR-18a/PTEN axis. Cell Biosci. 2018 Mar 22;8:23. doi: 10.1186/s13578-018-0221-7. eCollection 2018.
• Ref 2: MiR-18a upregulation decreases Dicer expression and confers paclitaxel resistance in triple negative breast cancer. Eur Rev Med Pharmacol Sci. 2016 Jun;20(11):2201-8.
• Ref 3: [Urothelial carcinoma-associated 1 enhances tamoxifen resistance in breast cancer cells through competitively inhibiting miR-18a]. Beijing Da Xue Xue Bao Yi Xue Ban. 2017 Apr 18;49(2):295-302.
• Ref 4: Long non-coding RNA UCA1 desensitizes breast cancer cells to trastuzumab by impeding miR-18a repression of Yes-associated protein 1. Biochem Biophys Res Commun. 2018 Feb 19;496(4):1308-1313. doi: 10.1016/j.bbrc.2018.02.006. Epub 2018 Feb 7.
• Ref 5: Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer. Biochem Biophys Res Commun. 2019 Aug 27;516(3):831-838. doi: 10.1016/j.bbrc.2019.06.125. Epub 2019 Jun 28.