Molecule Information

General Information of the Molecule (ID: Mol01330)

• Name: hsa-let-7c ,Homo sapiens
• Synonyms: microRNA let-7c
• Molecule Type: Precursor miRNA
• Gene Name: MIRLET7C
• Gene ID: 406885
• Location: chr21:16539828-16539911[+]
• Sequence:
  GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUA
  CAACCUUCUAGCUUUCCUUGGAGC
• Ensembl ID: ENSG00000199030
• HGNC ID: HGNC:31480
• Precursor Accession: MI0000064

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral cancer [1]

• Sensitive Disease: Oral cancer [ICD-11: 2B6E.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: GNM cells; Oral; Homo sapiens (Human); CVCL_WL58
• In Vitro Model: SAS cells; Oral; Homo sapiens (Human); CVCL_1675
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The inhibitory effect of let-7c on various stemness phenotypes was reverted by IL-8, indicating that lower expression of let-7c may confer higher cancer stemness through a failure to downregulate IL-8.

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: IL6/STAT3 signaling signaling pathway; Inhibition; hsa04659
• In Vitro Model: TE8 cells; Esophageal; Homo sapiens (Human); CVCL_1766
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• In Vitro Model: TE10 cells; Esophagus; Homo sapiens (Human); CVCL_1760
• In Vitro Model: TE1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: TE11 cells; Esophagus; Homo sapiens (Human); CVCL_1761
• In Vitro Model: TE5 cells; Esophagus; Homo sapiens (Human); CVCL_1764
• In Vitro Model: TE9 cells; Esophagus; Homo sapiens (Human); CVCL_1767
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Let-7c directly repressed cisplatin-activated interleukin (IL) -6/STAT3 prosurvival pathway, restored sensitivity to cisplatin and increased rate of apoptosis after exposure to cisplatin.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [3]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Tunel assay
• Mechanism Description: Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells.the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [3]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Tunel assay
• Mechanism Description: Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells.the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells.

Disease Class: Lung adenocarcinoma [4]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Caspase-3 signaling pathway; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic Let-7c expression could increase the sensitivity of docetaxel-resistant LAD cells to chemotherapeutic agents or irradiation and reverse their EMT phenotype by targeting Bcl-xL.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [5]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Hedgehog signaling pathway; Inhibition; hsa04340
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-200b and let-7c, inhibited the TGF-beta1-mediated resistance of NSCLC cells to erlotinib.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [6]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ERK signaling pathway; Inhibition; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The upregulation of let-7c was associated with the increased gefitinib sensitivity of H1975 cells, and that this effect was mediated by repression of the RAS oncogene and inactivation of the phosphoinositide 3-kinase (PI3k) /AkT and mitogen-activated extracellular signal-regulated kinase (MEk) /extracellular signal-regulated kinase (ERk) signaling pathways.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [7]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.

References

• Ref 1: Let-7c restores radiosensitivity and chemosensitivity and impairs stemness in oral cancer cells through inhibiting interleukin-8. J Oral Pathol Med. 2018 Jul;47(6):590-597. doi: 10.1111/jop.12711. Epub 2018 Apr 17.
• Ref 2: Let-7 expression is a significant determinant of response to chemotherapy through the regulation of IL-6/STAT3 pathway in esophageal squamous cell carcinoma. Clin Cancer Res. 2012 Sep 15;18(18):5144-53. doi: 10.1158/1078-0432.CCR-12-0701. Epub 2012 Jul 30.
• Ref 3: Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells. Oncotarget. 2016 Sep 20;7(38):62474-62489. doi: 10.18632/oncotarget.11518.
• Ref 4: Let-7c governs the acquisition of chemo- or radioresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant lung adenocarcinoma. Mol Cancer Res. 2013 Jul;11(7):699-713. doi: 10.1158/1541-7786.MCR-13-0019-T. Epub 2013 Apr 5.
• Ref 5: Inhibition of Hedgehog signaling sensitizes NSCLC cells to standard therapies through modulation of EMT-regulating miRNAs. J Hematol Oncol. 2013 Oct 7;6(1):77. doi: 10.1186/1756-8722-6-77.
• Ref 6: Fulvestrant increases gefitinib sensitivity in non-small cell lung cancer cells by upregulating let-7c expression. Biomed Pharmacother. 2014 Apr;68(3):307-13. doi: 10.1016/j.biopha.2013.10.007. Epub 2013 Nov 7.
• Ref 7: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.